ZFIN ID: ZDB-TSCRIPT-090929-19775
Transcript Name: ctsbb-201
Previous Name: ctsbb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039482 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039482|OTTDARG00000028851|ZDB-GENE-070323-1 ctsbb|OTTDARP00000031581 ctsbb-001 LG_ CU207296.22 Danio rerio protein_coding KNOWN, 375 bp
ATCACATTAGTGAATCTTCAGCTTGAGGAACAGAGGAACA
GACTTTAATGCTCAGTGTGAGGATGTGGCGTGTGTGTGTG
TTCGCTCTTCTGTCCGTTACGTGTGCTCGTCCACAGCTTC
ACACACATGATGAGATGATCAGCTTCATCAATGCAGCCAG
AAGCACATGGACGGCAGGTGTCAATTTCGACAATGTGCCA
AAAAAATATCTGAAATCTCTGTGTGGGACGGTTCTGAAGG
GCCCAAGATTGCCACATACTGTGAAACACTCCACAAACGT
GAAGCTTCCAGACAGTTTTGACCTGCGGGACCAGTGGCCG
AACTGTAAGACCCTCAACCAGATCCGAGACCAAGGGTCCT
GCGGCTCCTGCTGGG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ctsbb-201 Contained in:
[BAC] CH73-107C13 (1)

Genome Resources: Vega_Trans:OTTDART00000039482 (1),  Ensembl_Trans:ENSDART00000161050 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC115254 (1) 2091 nt
GenBank:CK869354 (1) 897 nt
CITATIONS (2)