Transcript

ctsbb-201

ID
ZDB-TSCRIPT-090929-19775
Name
ctsbb-201
Previous Names
  • ctsbb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039482 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039482|OTTDARG00000028851|ZDB-GENE-070323-1 ctsbb|OTTDARP00000031581 ctsbb-001 LG_ CU207296.22 Danio rerio protein_coding KNOWN, 375 bp
ATCACATTAGTGAATCTTCAGCTTGAGGAACAGAGGAACA
GACTTTAATGCTCAGTGTGAGGATGTGGCGTGTGTGTGTG
TTCGCTCTTCTGTCCGTTACGTGTGCTCGTCCACAGCTTC
ACACACATGATGAGATGATCAGCTTCATCAATGCAGCCAG
AAGCACATGGACGGCAGGTGTCAATTTCGACAATGTGCCA
AAAAAATATCTGAAATCTCTGTGTGGGACGGTTCTGAAGG
GCCCAAGATTGCCACATACTGTGAAACACTCCACAAACGT
GAAGCTTCCAGACAGTTTTGACCTGCGGGACCAGTGGCCG
AACTGTAAGACCCTCAACCAGATCCGAGACCAAGGGTCCT
GCGGCTCCTGCTGGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations