Transcript

heatr5a-002

ID
ZDB-TSCRIPT-090929-19719
Name
heatr5a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039423 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039423|OTTDARG00000028813|ZDB-GENE-030616-152 heatr5a|no_translation heatr5a-002 LG_ BX465838.15 Danio rerio protein_coding KNOWN, 635 bp
CGCACTTTCAGGCAAGCAGATGTCTTTGAGGAATTACACA
CAAACAACCGACTCAAACAGAGAAATACCTCTCTCACTGC
CCTCCCCCTTACAATACGGTTGATGGATTCAGCAGAGCAG
ATGGATGCTTCTAGAAGGTGAGAGGTGCTGCGGTCGTGGG
TCTCAGGTGAAAAGCTGCAGGGAGCCAGGAAGATGGAGCA
GGCTCATAGTTTACTGCTCAACGAGGAGGCCTGCAGTCAG
CTGCCGGAGCACCAGAGGGCTGAGTTCGTCTTCGAGTGGC
TGCGCTTCCTCAAGAAACTTCTCCCTGCCACAGACCGGGC
TGATGTAAAACAGAAACAGAAGCGTCTGGTGGAGCAGCTG
ACGACAGTACTGACGAGTTCTCCGGGTCCCCCGACGCGTC
TGCTGCTGGCACAGTGCCTAGCGCTAGTGTATCGAGTGGG
CGACTCCCTCACGTCCAGCCTCACTGTGGACCGCTGTAAT
GATATCATCCGCAGCAAGGATGACTCTCCCAGCACTCGGC
TGTCTTAAAAGCGCTGATGGCCTCCGCTCCGCACATGAAA
GCCAGACTGGAAGCAGCAGTCAAGGGGAACCAGGAGAGCG
TGAACTCTAAAGCACAAGCACCTCCAGCCATCAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations