ZFIN ID: ZDB-TSCRIPT-090929-19718
Transcript Name: heatr5a-203
Previous Name: heatr5a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039422 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039422|OTTDARG00000028813|ZDB-GENE-030616-152 heatr5a|OTTDARP00000031532 heatr5a-001 LG_ BX465838.15 Danio rerio protein_coding KNOWN, 6293 bp
ATGGAGCAGGCTCATAGTTTACTGCTCAACGAGGAGGCCT
GCAGTCAGCTGCCGGAGCACCAGAGGGCTGAGTTCGTCTT
CGAGTGGCTGCGCTTCCTCAAGAAACTTCTCCCTGCCACA
GACCGGGCTGATGTAAAACAGAAACAGAAGCGTCTGGTGG
AGCAGCTGACGACAGTACTGACGAGTTCTCCGGGTCCCCC
GACGCGTCTGCTGCTGGCACAGTGCCTAGCGCTAGTGTAT
CGAGTGGGCGACTCCCTCACGTCCAGCCTCACTGTGGACC
GCTGTAATGATATCATCCGCAGCAAGGATGACTCTCCCAG
CTTCCTGCCTACCCGACTGGCAGCTGTGGCGTGTTTGGGT
GCGCTGTATGAGCAGCTGGGCCGACTGCTCATCAACTCAT
TTAAAGAGACCACAACAAACCTTCTGAAAGCTATGAGGAG
TGCAGAGGGTCGCTGTGAGATCATGCTGTGCGTTGAGAGG
ATTCTGAGGGGTTTAGGTGTAAGTGCTGTATCCTGTCACA
GAGACATCTATAAAGCTGCTCGCACTGGTCTCACTGATCG
CTCCATGGCTGTGCGCTGTGCTGCTGCAAAGTGTCTTTTG
GAGCTCCAGCGAGAGGCTGTCTTCCTGTGGTCCACAGAGC
TGGAGAATGTGGCCACTCTTTGTTTCCGAGCGCTTGAGGG
CTCAAACTACGATGTCCGAGTCAGCATCTCAAAGCTGCTT
GGCACTTTATTAGCATCAGCACTGGAGCCCAGACAGGCTA
TAGCTCCGAGGCCGGGCTCCAAGCGCAGCTCCCTGGAGGA
GGTGATGGAGCTTCTGAGCTCTGGTTTCCTGCGGGGTGGA
GCTGGCTTCCTGCGGGCCAGTGGAGACATGCTGAAAGGGA
CCAGCTCAGTCAGCAGAGATGTGCGCGTGGGCATCACACA
GACATGTGTGGTGTTTGTGTCTATTCTGGGTGGTGTGTGG
CTGGAGACGCACTTCTCCAGACTTCTTTCTCTCCTCATGG
AGTGGGCATCTCACACGCGGGCCACACAATACCCAGCAGA
TGCTGTGTCTTGCCGCTGCTGTGTCTCCTTCATATTGCGG
GCCACTCTTGGCACTCTGCTAGGGGAAAAGGCCCAAATTG
CCGCTGCCAAGGAGATCTGTCAAGTGATCAGCAAACAGAA
GAGGGTTGTGGATGCATCTCTTCATGAAGGAAACATGGAA
ACGCGTGTGAGCCCTGCGGATGTTGCAGCCAGTCAGCATG
TGTTGGTGTGTGCCCTGCTGGAGCTGGGCAGTTTGGTACA
GGACCTGAGCTCTACTGCTGCTCCATTGTTGCAGGACACT
GGAATAGGAATGTTGGACACCGTGATCTCTGTTCTTCTTC
ACCCCAGTGCATCTGCTCGTCTGGCCTCCGCCTGGTGCCT
ACGGTGTATTGCCGTAGGGATGCCAGCTCAGGTGGCGGTG
TTGCTAGACCGCTGTGTAGAGAGGCTCAATGCCCTGAAGT
CATGCCCAGAGGCCGTGGCAGGATACAGTGCTGCCATCGC
TGCTCTGCTGGGGGCCGTACAGCTCTCTCCGCTGGGAATA
TCACATTCAAAGGGCAAGATGGTGATGACTTTGGCTGAAG
ATCTGCTGAGATCTGCAGCTCAGAACAGCAGAATCTCCAT
TCAGCGCACTCAAGGAGGCTGGTTGCTGCTCAGTGCCCTC
TCAACACTAGGTCCCACTGTAATGGAGCATCACTTGCCTC
GATTGCTGTTACTGTGGAAATGTGCCTTCCCGCTGTCTGT
AAAGGATGTGGAGATGGAGCTGCGGCGTGGAGACTCTTTC
ACCTGGCAGCTTGTGGTCTTCCCTGTAGCAATGAAGAGTC
TGGTGGTTCATTGTAAAGAGCTTCTCACTGATGATGTCAT
CTGTCGCTTTGTTCCTCTCCTGTCCTGTGCGGTGGCCCTA
CTAACTCAGCTGCCGTCTATTATTAAATCTTATGGAAATC
AGATAAAAAATGCAGCAACAGTCTTTAAATTAAGATTGTA
TGAGATCCTCAAGTTGCTTCAACCTAAAATCTATGAAGAG
AGTTTTGGCACAGTTCTAAAGCAGCTGCTGAATGATCTGA
CCGGGCCAGAAATCACAGCATGTGCTGAGCGGAACCTGCT
GCCCTCCCTGTGCTACAGCCAAGACCTTGCTCTGCTGGGT
CCCGGACTGCAGGATATGGATCAGCGCTATATAGAAGAGC
AGCTGCATGGAGGTGGTTCAGGAGGTGGGACACTAGAATA
TGACTCATTTACCATCTTTGAGAAATCTCAGGAGGTCCTG
GAGCAGTTTTGTGAATTTGTGCGACAGCTTAAAGGAGCTC
GGCAGCAAACAGTCCAAATACACGTAACTGCTGCTTTCTT
TTGCACTTTGAAGAGTTTGGCATCAAGTCGGAGCGAATTG
GGGCCAGAGGAGGTCCAAAGACCAGCATTGTCTCTCCTGT
TGGGGGCGTTGGAGGGCTCAAACCCTCTACTGCGCTGCAT
GGCTGCAGAGGGTTTAGCAAGGCTGGTGCAAGTTCTTAAT
GACCCCGGCTTCACAGTTTCCCTCACTCTCATGAGCTTTG
ACAAACTGAAGACAGCAAGGGATGCCATCACACGCACAGG
CCATGCCTTGGCCCTCGGAACGGTTTACCGTTATCTTGGT
GGGATTAGCTCCCCTCAGTACCTCAGTGCCTGTGTTGGGG
TTCTTTTTACCCTGTCCCAGGATAATACCTCACCAGAAGT
AAAGATGTGGGCTCTTCATGCTCTGTCCACTGTGGTGGAC
CTAGCAGGTCCTTTGTACCACAGTCACCTGGAGGCCAGCT
TCACTCTGGTGCTGCGTTTGCTCCTCTCTACCCCACACAC
ACACATGGAGGTGCAGCAAAGCCTGGGCCGCTGTCTTAAC
GCCCTCATCACCTCTGTGGGGCCGGATCTGCAAGGTGAGG
GTGCAGGTGTGTGTGCGGTGAGGACCTCGTGTTTGGTGGG
CTGTGCTGTGATGCAGGATAGCCAGGACTGTTTAGTCCAG
GCTCAGGCCATCTCTTGCCTCCAGCAGCTGCACATGTTTG
CGCCACGCTTCGTCAATCTGTCCAGCCTTGTGCCAAGTCT
CTGTATAAATCTGTGCAGCTCATACCTGTCTCTGCGGCGA
GCGGTTGTGGCCTGTTTAAGACAGCTGGCTCAGAGAGAGG
CAGTGGAGGTATCGGAACACGCAGTGGCTCTGGTTAAAGA
GCTTCCCCGCAGAGACAACACACAGCTGGATGTCACTATT
AAGGAGGTGGGCTTGGAGGGAGCTTTGTTCAGTCTCCTGG
ACAGGGAGTCGGATCCCCGCCTGTGCAGAGACATTCAGGA
AACACTGGTCCATATGATGAGTTCAGCAGCTGAGAGTAAG
CTGGCCCACTGGCTGAAGCTCTGCAAAGATGTACTGTCCG
CTTCTGCAGACTCCGCTGCAGCCGCCTCTGTAGAAACCCA
GCAAGAGGAGGATGGAGATCGATATGATGACTCCTCTGCA
TTCCATGCAAAATCTGAGTCCAGCGGGCCCTTCAATAACC
TGCGCTGGTCCACTCGTGTGTTTTCTATGGAGTGTGTGTG
TCGCATAATAGCACAGTGTGAGAACAGAGACTCAGCTCAC
TTTAACATGGCACTTGCTCAAGAGCAGCGTTTACATGAGT
CCACAGATTTCCTGGTTCTTCACTTGGCGGATCTGATCCG
CATGGCGTTCATGGCATCCACAGACCACAGTGACCAGCTC
CGACTGGCTGGTTTGCAAACGCTTCTGGTCATTATTCGTA
AATTCTCCAATGTACCAGAGCCTGAGTTCCCTGGGCATGT
CATTCTGGAGCAGTATCAAGCCAATGTTGGAGCTGCGCTT
AGACCTGCCTTCCATGTGGACGCTCCTCCAAACGTGACCG
CCAAAGCTTGCCAGGTCTGCAGTGCATGGATCGCCAGTGG
GGTCATCAGTGACCTGCGGGACCTGAGAAGGGTACATCAA
CTTTTGGCATCCTCTCTGGCCAAAGTGCAGGTGGGGAGAG
ATGTTCCCAGTCAGCTCTATAATGAAAGCACCTTCACCAT
GGAGTCGCTGGCGGTGCTCAAAGCCTGGGCGGAGGTCTAC
ATCACAGCAGTGCAGGGCTCTAGGCAGAGGGACAGTCCGG
TCAGTCATCAGCAGCAGCAGAGTGAGGAGGCTGGGACTGC
AGGTCAAGCAGGGGCTGGTTTGCTCAAACTAGTTCAGACT
GATCTGGCAACCCTGAGTCGCCTATGGCTGGCAGCCCTTC
AGGATCATGCCCTGCTCACACTGCCCCCACACTACTCTAG
TCATCTTCCCTCCACAGGCGGCTCATTTTACACTGCAGAA
ACGGTGGAACAGGCCCGTCCACATTACTACAGTGCCTGGG
CAACCATTCTCCATGCCACTGCCCTCTGGCTCAACAGCAC
CGGCTTTATCGTGGTGGATGAGGGCCCTGCAAACCTTTCC
AGGCCCGTCACGCCCACTTCCATGGGCCAGTCCACATCAC
TGAGCAACGTTAAATCTCCAGAGGACATCAACAGTGATCG
CCTACACCTCATCCTTGGGATCAGTGTGGAGTTTTTGTGC
TCTCCTCATTCTGGAGACCAAATGGAAAACATTCATTCAT
GTCTTCAGGCTCTGCAGGCCTTATTGGAGGTGCCTTGGCC
TCGCTCAAAAGTGGGCAATGATCAGGCTCTGAGTGTGGAG
CTGCTTAGCATCCTGCATAGGCTCATAGTCACTCGGGAAT
CTCCCAGCATTCAGCTGGCTGTGCTGGAACTGGTGCAGCA
GATTATTTGTGCAGCTCAGGAACACGTCAGAGAAAAACGC
CACAGCGCAGAGGTGGATGACGGTGCGGCAGAGAAGGAAA
CAGTTCCTGAGTTTGGTGAGGGACGAGACACTGGTGGCCT
GGTGCCAGGGAGATCTCTCGTGTTTGGAGCACTGGAGCTG
TGTCTCTGCACGCTTGTGAGGAAGCTTCCGCAGCTCAGCC
CCAAACTGACCGGCAGTCCCACGGGACGGGGAGGACAGAC
GTGCTCCCTCAGCGCCACTGACTGCAGACTCGTCACATCT
GCTCTGGCCATCCTCTCTGAACTGCCCTCCATCTGTTCAC
CAGAGGGCAGTGTGTCAGTGCTGCCCACAGTGCTGTATCT
GCTGCTCGGGGTTTTGAAAGAGGCAGTGAAAGGCTCTGTT
GGAACTGAGAGTGGACAGCTGGTGTCAGGCATCCTGCAGG
CCCTGCGCACTCTTCTCACTTCTCCCATGAGCAGAGCTGA
GAAGAGTCGTGGGGCCTGGACTCAACTACTGCAATGCGCA
CTTCACACACTCCTGGAGTCCTGGAGTACAGATAAAGTGG
AGCCTGGAGTAGATGAGGTCACCATGTTGACATCGCTCAC
CATCTTCCTGCTGTACGCCAGCGCTGAGGTCACCTCTGTA
GAGCCACTGCAAACCCGCTGCATCCAGACATTCAGAGCAA
GTCTGGACTCCAAAGACCCCGTGGTGCTGAGCAGGAGTTA
CCAGTTGCTATTATCTTTATTTCAAGGCCCAGCGCCAGTA
GCAAGGCCATTTATTCTGGCTCTAGGTGGTCGTCTGGTGT
CTCAACTGGAGGAAGCTGAAAAGAGTCGTCCTCAAGGCCC
AGCAGAGCTACAGGCCGTACAAGATGCAATCCGGGCCCTG
GAAGCACTAGTGTTTGCTGCGGATGAAACTCACCGTCCTC
AGCTGGTGGCTGTGCTGCTGCCTATCCTCATCTCCCTCCT
CTTAGATGAGAATGCTTTGGCATCGGCTCCGGCGGCTTCT
CGCTTGCTGCACGAATCTGCCTTGAGAGACCTCATGCGCA
TCGGCCCCCAGCACTCGGCTGTCTTAAAAGCGCTGATGGC
CTCCGCTCCGCACATGAAAGCCAGACTGGAAGCAGCAGTC
AAGGGGAACCAGGAGAGCGTGAACTCTAAAGCACAAGCAC
CTCCAGCCATCAGCAAAAACACACCCAGCATTCAACTGAA
GATCAATTTCCTCTGAATCCAGTATTACGATAGAAATGAC
TGAGTGAATGTTTTAATCAGTGGTGTTTTAACGATAAATC
ACTTTAAAACTTGTGTCATTTAATAATTGTAGTCCGTTTC
AGAAGTGCATTAACCTCTATGAGGATATTAATACTTATTT
ACTTACAGAACGCAAGGAAAGGGGTTTTACAGGAATCGAC
TCAATCCTGGAAGTGAATGGCTTTCATTTATCTATTTTAG
TCATCATGCAGTTTTGTGATGGGTTTTATTATTATCTGTT
TAAAGAATGCAAATCATTAATTTCTCATCAACATGCTGCA
TTTCACAACTCAG

heatr5a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA heatr5a-203 6293
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
heatr5a-203 Contained in:
[BAC] DKEY-11J8 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000039422 (1),  Ensembl_Trans:ENSDART00000143607 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT676587 (1) 780 nt
GenBank:CT588781 (1) 754 nt
GenBank:CT619285 (1) 748 nt
GenBank:CK029049 (1) 743 nt
GenBank:BG738292 (1) 600 nt
CITATIONS (2)