Transcript

g2e3-002

ID
ZDB-TSCRIPT-090929-19717
Name
g2e3-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039421 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039421|OTTDARG00000028811|ZDB-GENE-030616-400 g2e3|no_translation DKEY-18B8.4-002 LG_ BX324186.12 Danio rerio protein_coding KNOWN, 349 bp
GCGAAGTTTGAATTTGTGTAATGCGATTTACACTTTTACG
CGCACGAATGTCTCTAAAGTAATATTAAAAACTCGACTTT
TCCTGGAGAATATGTATATTTCTATCTGATGGAAGAAGAA
GACTGACTTTAAGATAAAGCTCGCGAAAAACGTTAAATGA
AAAGTCCGCTGAAATAAAGCTGCAGGACAGAGATCTCATT
TGCTGTCTATGTAAGAGATCTGAGAATAATAAAGAGAAGT
ATGGAGAAAAGGTTCACCTTGAGCAGCACAACCTGGCTGT
CCACTTTTTTTGTCTGCTGATGTCTAGTGGAATATGCCAG
AGAGGAGAGGAAGATGAAGACGTGTATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations