Transcript

g2e3-201

ID
ZDB-TSCRIPT-090929-19716
Name
g2e3-201
Previous Names
  • g2e3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000039420 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039420|OTTDARG00000028811|ZDB-GENE-030616-400 g2e3|OTTDARP00000031531 DKEY-18B8.4-001 LG_ BX324186.12 Danio rerio protein_coding KNOWN, 3360 bp
GTTTCCGCAGCTCAAATGTTTTGGCCAGAGCTCCTCCCTC
CGGAAAATCTGTGTTTGGGTTTGAATTGAACCAATCAAAT
GCGCGCGGAGGAGGATTTTCACGAGCAGAGCGAAGTTTGA
ATTTGTGTAATGCGATTTACACTTTTACGCGCACGAATGT
CTCTAAAGTAATATTAAAAACTCGACTTTTCCTGGAGAAT
ATGTATATTTCTATCTGATGGAAGAAGAAGACTGACTTTA
AGATAAAGCTCGCGAAAAAGTGAGTCTGAAGCCGTGTAGG
TTAACGTTAGCCATGTACTGCTAGCCTTTAACTTGGGGCT
CTTTAAATCGCCATTTTAAAATTTAACTTTACATTTGACT
TCCCCACCTAAAAATGAAAGCGTTAAATGAAAAGTCCGCT
GAAATAAAGCTGCAGGACAGAGATCTCATTTGCTGTCTAT
GTAAGAGATCTGAGAATAATAAAGAGAAGTATGGAGAAAA
GGTTCACCTTGAGCAGCACAACCTGGCTGTCCACTTTTTT
TGTCTGCTGATGTCTAGTGGAATATGCCAGAGAGGAGAGG
AAGATGAAGACGTGTATGGTTTTCTTGTGGGTGACATTAA
AAAGGAGATCCGCAGATCATCGAGGCTGAGATGCTTTCAT
TGCAAAAAGGCTGGTGCTTCAGTGGGCTGCTCCATCAAAA
GCTGTCGGCAAATGGTCCACATGCCCTGTGGATTAGAGCA
GGAGTTTGTTTTCCAGTTCACAGGCTTGTTTCCGTCTTTC
TGTAAAAAGCATGCGCCTACTCAGTCCTGTGACTCCAGCC
ACAGTCTGCCCCACTCCTGCTCCATCTGTCTAGATCCCAT
TGAACCCATCCTCTCCTATCATGTCCTCAAATGCCCTGCA
TGTCATGGAAGCTGGTTTCACAGGAAATGTGTACAGAATT
ATGCACACAGCGCGGCAATGTTTTTCTTTAAATGCACACT
CTGCAATAACAAGGAGCAGTTTCAGCAGGAAATGCTCCGA
ATGGGAATATATATACCAGAGCGTGATGCATCTTGGGAAC
TGGAGGAGAATGCATTTGTAGAGTTATTGCAGGTCTACCA
CCGCTGTGATGCAGTGAAGTGTCTGTGTCACAAAGGTCGT
GAACACAGCTCACAGTCAGGGTATTTTGAAATAGTTCTCT
GCAAGTTGTGTGGATCCAGGGGAACTCATCGAAAGTGCTC
TAATATTCGAGTTTATGAAGCTGACTGGATGTGTGCTGAC
TGTAAAACTGCAGCTGAGGGCAAAACATCATTGCCATTGC
CAAATCATGTTGAATCGCCACTGGCTATAAGACAAGAGAG
GAAGAGGCTGTTTAAATCGATCTCTGACATTCACTCTTCA
ATCGTCGCTAAAAGGCAGTGTGTGCCAGCCACTTCTCCGG
AGGTCTTAATGGATCTGGCCTGTCAGATCTCACAGCAGCA
GTTCACAGAGGTGCTGGTGGGAGATGATGATGGTGGCGTG
ATGGAAGCAGCTCTGCAGGTGCTGCGCCAAAGTGACTTTA
ATCCCTGCTGCACACTTTCTGTCAAATTCTCCAAGGACAA
ACTGAACAACAACATTAGAAACCAGCGTCGCTTCCTCAGG
CGTCTCGTTTCAAAACTGCAGGTCTCAGACATTTTTGAGG
GATCCGATGGAGCTAAAAACCTGGCTCTGAACTCAAAAGC
TCTGAGGGACGATCTCTACTTTGATGTCGGCAGTCTATTG
GCCCTCTCTTTGGTTCACGGAGGTCCTCCTCTGGGCTTCT
TCTCTCCTGCACTGTATCATAGTCTGTTCAACTATCCCAA
AAACTACAGGCCTACTTTAGAAGACCTCGGAGACACTGCT
TTTGGGCACAAAATCAGACAAATCGCAGAAGCAAAGTCAA
TGAAGGAGCTGAGACATGCGATGAAGTCAGCATCACAATA
TTTGGAAGCTGCAGGCTGTTGGCGGAAGATCAGCAAACTC
TCTGAGAAAGACATGTTGGTGGAGGATGTACTGAATTTCT
ACCTGATCATCAGACTGCAGCTTCCTCTGCAAAGATTCCG
TGAAGGTTTGAGGACACTAGGAATGTTCGAGCAGGTCCAG
ATGTGCTCAGAGACGTTCTTTCCAGTCTTCTGTGGACCTG
TGGAAAGGCTGACGGCTGAATCTGTCATGGAGCTCTTCAC
AACCCGGTTATCAGAAGAAAAAGAAAAACAAGTTCTAGAA
AAGACCACGATAAGCTTTTGGAAACAGTATCTGCATGAAT
GTGAAGAGGGTCAATGTGCAGCATCGCTGGAGGACCTCCT
AACATTTGCCACTGGTACAGATTTGGTTCCAGCCATCGGA
TTCAAGCCCACTCCGTCCATCTCATTCCTCAGCTCACCAG
ACAACTTGTGTGCTTTTCCTCAGAGCAACTGTGATGCCAA
TCATCTCATTCTGCCTACTCTACCCTCTTACCAGCTCTTC
AAGAAACATTTGGATTACACAGTGTGTCAGTTCTCAGTTA
TGCAGGACATTTAAAGCCGAGCTGGATGTTTCAGTAGAGT
CATGGTGTAGATTCACATAATGATTTACAATGGTGCTAAA
AGTCTTTTTGTTTGCAGTTAGCGAGTATTATATCAACAGT
CTTAAATCGCATTAATGTAAATGATTCACTCTATTTATCA
GTAGTTAAACGCAGGTTTTAGAACTTGATGAACTCTGTGT
TGTTTAAATGGTCTCAGTTATTGATCCAATTTAATTCTCA
AAACAATTTGAGCCACTCAACTATTGAAGAAAAACTCTGA
GGTAATATTTTCTACAGAAGCTTAGACTCATGGAAAATTT
GTTTTTAAAAAAAAGATTATATGTGTGCTTTTCTTATCAA
TTTAGACTTGAAGAGATTGGTAAAGCTGGTCATGAGCATG
TAAATGTAAATAGCTTAATGTAAATGTTGCTTTGAATGGC
TTAGATGTTGATTTTATTAGCTTAGAAGTGCAGAGGTTTT
TAAACCAAAGCCCAAAGTAGTTGAGTAGTAATGAGTTGTT
ATGTTCTTTGTTTAATTTTGATTTTTCTTATAAAAAAAAA
AAAACTGCAAAGCTTAAATTGACGCGCTTATAATTTTCTG
GTAGCCACAAGATGGAGCAATTGCAAGATTTTTGCCACAC
TGCTAATGGCAAAATGCCGTCACTACAAATGAAGTAGTTA
CTGAATGAATTGGTCTGCTTTGCTTGTCATTTACATTAGA
ATCACATTTAAGCAGGTATGTCTTTGTTCTTGTACAGTTT
TATTTCTCCTGATGTCGTTTGTTTGATATCTTGACAACTC
GATAACTGCTATAACTTATTTGTTTTAACTTTCTTTTACT
GTGTTTACTTTCATTAAATAATGAATGGATTTATAATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations