Transcript

med23-201

ID
ZDB-TSCRIPT-090929-19715
Name
med23-201
Previous Names
  • crsp3-002
  • med23-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039419 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039419|OTTDARG00000028810|ZDB-GENE-040724-82 med23|OTTDARP00000031530 med23-002 LG_ BX072559.10 Danio rerio protein_coding KNOWN, 4289 bp
CGACGCTCAAGCTTCTGGTGTTTCAGTTCTGGCGCTGCTC
TTCTGTTGTGTTCATCAGAGCCTCATTCAGCGTTAATTAA
AAACTACAGCGCACACTTTCATTTCAGACATGGACGTATG
AGTGTGCGTGAAGGTGTGTGCTCGTGATGGCGGTCCCGAT
GGAGACTCAGCTGCAGAGCATCTTTGAGGATGTAGTGAAA
ACGGAGGTGATCGAGGAGGCGTTTGCTGGCATGTTCATGG
ACAGCCCTGAGGATGAGAAGACCAAACTCACAAGCTGTTT
AGGAGCCTTTAGGCAGTTCTGGAGTACCCTGCCGCAGGAG
TCTCATGAGCAGTGTGTGCAGTGGATCGTGCGCTTCATTC
ATGGTCAGCACAGCCCCAAACGCATCGCCTTCCTCTACGA
CTGTCTGGCCATGGCGGTGGAGACCAGCCTGCTGCCACCC
AGGATGGTGTGTCAGGCTCTCATCAGCTCCGACAGTCTGG
AGTGGGAACGGACTCAACTCTGGGCTTTGACCTTCAAACT
CATCCGCAAAATCATCGGAGGAGTCGACTATAAGGGTGTG
AGAGATCTATTGAAGGCCGTGTTGGACAAGATTCAGACCA
TCCCCAACTTTGTGAGCTCAGCTGTGGTTCAGCAGCTGCT
CGCGGCACGAGAGGTTGTGGAGTATATACTGGACCGCAAC
GCCTGTCTGCTGCCGGCGTACTTCGCTGTGACTGAGATCC
GGAAACTTTGTCCAGAGGGGGCGCTCTCACACTGGCTGTT
GGGCAGCCTGATATCTGACTTTGTCGACAGTTTCAGACCG
ACGGCACGTATAAACTCCATATGTGGGCGCTGCAGTCTTC
TGCCTGTGGTCAATAATTCTGGGGCCATCTGTAACTCATG
GAAGCTGGACCCCACCACTCTGCGTTTCCCTCTGAGAGGA
ATGCTGCCGTATGATAAGGACCTGTTTGATCCGCAGACAG
GGTTGCTGAGGTATGTGCTGGAGCAGCCGTACTCCAGAGA
CATGGTGTGCAACATGCTGGGCCTCAACAAACAGCACAAG
CAGAGGTGTCCGGTTCTGGAGGACCAGCTGGTGGATCTGG
TGGTTTATGCCATGGAGCGCTCTGAGACTGAGGAGCAGTT
TGATGACGGCGGCACCAGCCAGCTCCTGTGGCAGCATCTG
TCCAGCCAGCTCATCTTCTTCGTCCTCTTCCAGTTTGCCA
GCTTCCCTCACATGGTGCTGTCGCTCCATCAGAAGCTGGC
AGGTCGGGGTTTGATCAAGGGCAGGGATCATCTGATGTGG
GTTCTGCTGCAGTTCATCTCCGGCAGCATTCAGAAGAACG
CTCTGGGAGACTTTCTCCCCGTCATGAAGCTCTTCGACCT
GCTGTACCCTGAGAAAGAGTGTATTCCAGTCCCGGACATC
AACAAGCCCCAGTCCACACACGCATTCGCCATGACCTGCA
TCTGGATTCACCTCAACCGCAAAGCCCAGAACGACAACTC
CAAACTGCAGATCCCCATCCCACACTCACTGAAGCTGCAC
CATGAGTTTCTCCAGCAGAGTCTGCGCAATAAGAGTTTGC
CCATGACAGACTATAAAATCGCTCTGCTGTGTAACGCCTA
CTCCACCAACTCCGAGTGCTTCACGCTGCCCATGGGCGTC
CTGGTGGAGACCATCTACGGCAATGGTAGCATGCGCATCA
CTCTGCCAGGCACCAATTGCATGGCGTCCGGCTCTGTCAC
GCCACTGCCCATGAACCTGCTGGACTCCCTAACCGTCCAT
GCTAAGATGAGTTTGATCCACAGCATCGCCACCCGTGTTA
TTAAACTAGCCCACGCTAAGTCCAGTCTGGCTCTGGCTCC
TGCGCTGGTGGAGACGTACAGCCGGCTGCTGGTCTACATG
GAGATTGAGTCGCTCGGCATCAAGGGATTCATCAGTCAGC
TTCTGCCGAATGTGTTCAAGTCTCACGCGTGGGGGATTCT
GCACACACTGCTGGAGATGTTCAGCTACCGCATGCACCAC
ATTCAGCCTCATTACCGCGTGCAGCTCCTGTCCCATCTGC
ACTCGCTCGCCGCTGTCCCACAGACCAATCAGAACCAGCT
GCACCTCTGTGTTGAAAGCACAGCTCTGCGCCTGATCACG
GCTCTGGGTAGTTCCGAGGTTCAGCCTCAGTTCACACGGT
TCCTCAACGACCCAAAAACAGTGCTGTCGGCCGAGTCTGA
GGAGCTAAACCGAGCACTCATCCTCACACTGGCCCGGGCC
ACTCACGTCACAGATTTCTTTACAGGCTCGGACTCGATTC
AGGGCACTTGGTGTAAAGACATCCTGCAGACCATCATGAA
CTTCACACCTCATAACTGGGCCTCTCACACTCTTAGCTGT
TTCCCTGCTCCACTGCAGGCGTTCTTCAAGCAGAATAATG
TCCCTCAGGAGAGCCGCTTCAACCTGAAGAAGAACGTGGA
GGAGGAGTACAGGAAGTGGAAGTCCATGACCAATGAGAAC
GACATCATCACCCACTTCTCCATGCAGGGCTCGCCGCCGC
TCTTCCTGTGTCTGCTGTGGAAGATGCTGCTGGAGACGGA
CCACATCAACCAAATCGGCTTCAGGGTTCTGGAGCGCATC
GGGGCGCGAGCGCTGGTGGCTCATGTGCGCACGTTTGCCG
ACTTCCTGGTGTACGAGTTCTCCACATCCGCTGGCGGACA
GCAGCTAAACAAGTGCATCGAGATCCTGAACGACATGGTG
TGGAAGTACAATATCGTGACCCTGGATAGACTCATCCTCT
GCCTGGCGATGAGGAGTCACGAAGGGAACGAGGCTCAGGT
CTGCTACTTCATCATCCAGCTTCTCCTGCTCAAACCCAAC
GACTTCCGCAACCGCGTCAGTGACTTTGTGAAGGAGAACG
CTCCAGAACACTGGCTGCAGAGCGACTGGCACACCAAACA
CATGACCTACCACAAGAAGTATCCAGAGAAGCTGTATTTC
GAGGGTCTGGCGGAGCAGGTCAATCCTCCTATCCAGCTGC
AGTCTCAGTATCTGCCCATTTACTTCGGCAACGTGTGTCT
GCGCTTCCTCCCCGTGTTCGACATCGTCATCCACCGCTTC
CTGGAGCTGCTGCCGGTCTCCAAATCCCTGGAGACGCTGC
TCGATCATCTGGGAGGACTCTACAAGTTTCATGATCGGCC
GGTGACGTACCTGTACAACACGCTGCATTATTATGAGAGG
CACCTACGCGACCGCACAAACCTGAAGAGGAAGCTGGTGC
ATGCCATCATGAGCTCGCTGAAGGACAATCGAACACCCGG
CTGGTGCCTTAGCGAGACCTACCTGAAGTGCGGCATGAAC
GCCCGTGAAGATAATGTCTGGATCCCTGACGACACCTACT
ACTGCAAACTCATCGGACGCCTCGTGGATACCATGGCAGG
TAAATCTCCAGGCCCGTTCCCCAACTGTGACTGGAGGTTT
AACGAGTTCCCGAACCCGGCCGCTCATGCGCTGCACGTCA
CCTGTGTGGAGCTGATGGCTCTGGCGGTCCCGGGGAAAGA
CGTGGGCAATGCTCTGCTTAATGTGGTGCTCAAGAGTCAG
CCGCTGGTGCCTCGAGAGAACATCACGGCCTGGATGAACG
CCATCGGACTGGTCATCACCGCTCTGCCTGAGCCCTACTG
GATCGTCCTGCATGACCGTATCGTGAGTGTGATCAGCAGT
GCGGTGCTCAGCTCTGGGTCAGATTGGCTGGGTTACCCAT
TCCAGCTTCTGGACTTCACCGCTTGCCATCAGTCCTACTC
AGAGATGCACTGCAGTTACGTTCTGGCTCTGGCTCACGCC
GTGTGGCATCACTCCAGCATCGGCCAGCTCTCGCTCATAC
CCAAGTTCCTGTCGGAGGTCCTGAAGCCCATCGTGAAGAC
TGAGTTCCAGCTGCTGTACGTTTATCATCTGGTGGGCCCG
TTTCTGCAGCGCTTCCAGCAGGAGAGAACCAGATGCATGC
TGGAGATTGGAGTGGCGTTTTATGAGATGCTTCAGGCTGT
GGATCAGCACAGCAACCACCTGGCCTACATGGACCCCATC
TGTGACTTCCTGTACCACATCAAATACATGTTTACTGGGG
ACAGTGTCAAAGACCAGGTGGAGCGCATCATCTGTTCTCT
GCGTCCAGCAATGCGTCTTCGTCTACGCTTCATCACACAC
ATCAGTAAGATGGAGCCGGCGGCGGTGCCCGTGTCCAACA
GCAGCAGCGTCCAGCAGACCAGCAGCGCCTCCTCACCCAC
AGCACAGAGCACTGCTGGAGCCGCCATACCACTGTCTGTG
ACACAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations