ZFIN ID: ZDB-TSCRIPT-090929-19593
Transcript Name: armc1-201
Previous Name: armc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039293 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039293|OTTDARG00000028742|ZDB-GENE-041212-33 armc1|OTTDARP00000031437 CH211-78P4.1-001 LG_ CU019631.6 Danio rerio protein_coding KNOWN, 1842 bp
TGGTCTAAATTCAGGAAGTGTTACACGGTCTGCTAAAAAA
GCTCCGCAGATAATGGCCAAATAAACCGGACCAGAACAGT
TGGTCACACACAATTTTAACTTCGTTTACTGTCGTCCTCA
TATCCAGTCTGGTTTCCGTCAGCAGTTGATTTGTCGGTGG
TTTTGGATCCAGCAACTGGACAGGAATCATCCGAAGCGAG
GAGCGTCCTGGGCGTGTTTGCTCTTGGAGCGGTGTGTTTT
CTGTGCATGGCCCTTGGAGTGGGAGCAGCATGAGCGGGGA
GCCTGATGCCTTGGCTGTGGTGAATCAGCTGAGGGACTTA
GCTGCCGACCCCCTCAACAGGAGAGTTATAGTTGAAGATC
AGGGCTGCTTCTCCGGCCTCATCCTCTTTCTCGACCATCC
CAATCCTCAAGTCGTCTACTCCGCACTCTTGGCGGTGCGT
TACCTGGCAGAATGCCGTGCCAACCGGGAGAAGATGAAGG
GCGAGCTGGGAATGATGCTGAGCCTGCAGAACGTCATGCA
GAAAGGCACGTCTCCAGGAGAAACCAAGCTGCTGGCCTCT
GAGATCTACGAGATCCTGCAGAACTCCAGCAGTGCAGAGG
CTGAACAGGCAGAAGCCGGAGCCTCCTGTAGAAGAAAAGC
CCAGTTCTTCCTGGGCGCAACCAACAAACGGGCCAAAACT
GTGGTGCTTCAGATTGATGGGCTTGATGATTCGTCTCGGA
GGAGTCTTTGTGAGGAGGCTCTGCTGAAGATTAAAGGAGT
CATCAGTTTTACCTTTCAGATGGCCGTGAAGAGATGCGTG
GTCAGAATCCGCTCAGACCTGAAGGCAGAGGCCTTGGGAA
CTGCTATAGCTTCAACCAAAGTCATGAAGGCACAGCAGGT
TGTGAAAGGGGAAGATGGAGCAGAGCTTGTAATCCCATTC
CAGGAAGACTCGGACGTGGTTGTGGAGCAGAATCTGAATT
TGCCGGATTATCTGCCGGAGGATGAGAGCCCGTCTCAGGA
GCAGCACAAGGCAGTGACGCGCCTGGGCTCTGTTCAGGAT
GGCGTGAGCTGGCTAAACACGGCCGCTAACTTCCTGTCCC
GCTCGTTTTACTGGTGACCCCACGGCTCCCGCATGACCCG
CTCATTTTACAGCCCTGCCTCCACGCGCAAGACTGCCGAG
TGCATCTCGCAATAAACTTACAGCCCTGTTCCAACTTCAC
AAAAAAACGCCACGAGCGGCGGCAGTAAACGGTACGCGAT
CAAAACCCGCTCCTGAAACCTGCGTTTAGCGCTGCATACA
AACCACACCAGACACTAAAACCAGAGAGCAGCCGGGAGAC
GTTCACAGAAAGTATTTTGTGTCTATTTGCTCTCTCTCCT
ACTCACCGTATTGTTTGTTTGTTTGGTCAGGAGAAGGTTC
TCGAACGATCTGGGTTTCCCCGCTGGGTCGATGTTTTCTA
AATTTCTACGATTTTTTGGGGTGATTTCGGATGTGGTCTA
ACCCTTCATCTCAGCTTTCTTGTACATTTTATACAACATT
TTCTTTTGATATCCTAATATTACTTTATTAATTCATCTTT
TCAAAGCATGATGCCTTTTTTTTTTTTTTTTTGAGATCCA
CTTTCCTTCTGTGTGTGCCTTTTATATATTACGTAGCTTG
TTTTCTTGGTTTTAAATTCTCTTCATCTGCTTCGACTGAA
GACATGAGTTTTAGGTTTGTAATGTGTTGATGGTTCAGGG
AACTGATTCCGTATGATAAATCTTTCACACTCCAGCACTG
GCTGGTGTGCAGTAATAATATTAATTTGATAAATGAATAA
ATAACGGTTTGATGCCTCCAGATAAGGGAGGCGAAAATGG
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
armc1-201 Contained in:
[BAC] CH211-78P4 (1)

Genome Resources: Vega_Trans:OTTDART00000039293 (1),  Ensembl_Trans:ENSDART00000012399 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC154175 (1) 1869 bp
GenBank:BC086818 (1) 1837 bp
GenBank:DT874797 (1) 656 bp
CITATIONS (2)