ZFIN ID: ZDB-TSCRIPT-090929-19568
Transcript Name: dhx37-201
Previous Name: dhx37-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039267 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039267|OTTDARG00000028725|ZDB-GENE-030131-4505 dhx37|OTTDARP00000031416 dhx37-001 LG_ CU469504.8 Danio rerio protein_coding KNOWN, 3714 bp
TTTAACAGCTGCACAATATTACTACAGGATCAACACATCT
CCGTGTTTGGATGTGAAGAGTTGGCCATGGGCAGATTGAG
AAAGAAACACAACTGGAAAGGCAGACAGCAGAGCACATCT
GTGCAGACAGCAGCTGCAGACCGACAGACCAACGTGCAGG
TGGAGATACAAGATGGAGCTGTGCTGAAAGGAGTGGATGA
CTGTAATGCTCTGGTTCTGCCCGCCACCAAAACCAAGAAA
CAGAAAGTAGAGCGGCCTGTAACCAAGAAAAAAGCCCTGA
CAAAGAAACAGAGGAAGAACCTGGAGAAAGTTCTGGAGCA
GAAAGACAAGAAAGCACATAGGGCAGAAGTATTATCTAAG
CTAGCTGAGGTTCAGCTGCCCGAGGCGGAGCTCAAACTTC
TGTACACCACCGCTAAACTGGGCACTGGGGGAAAACTCTA
CCACATCAAAGAATCTGTGAATGAAGGTCAGGATGGAGGT
TCATCTTCGGTCAAGATCAGCAGTTTGAGCGGTGCAAACA
GGAAGAGAAGAAGAGAAGCGGATGAAGAGGAGGAGGAAAA
TGAATCAGAGATGTCTGAGTCCTCTGAGGATGATGATGAT
AGTGAGGAATCCGACTCATCTGAGGAAGAGAAGGAGAAAA
TCTCTGAGGAAAAACACACAGAAGAGCAGCAGCAGCAGGT
GCTGAAAGAGGAGACAAAACCGAAAGAGGCAGACATGAAA
GAAGAGAAGAAAGCGGAAACATGGACTAAGGAAGACTGTA
AACCTGCAGTTTTCATCCCAGTGGAACGACTGCCAGAGAT
TCAGGAGGCTCGTCTGCGGCTGCCGGTTCTGGCCGAGGAG
CAGATCATCATGGAGGCCGTGAAGGATCACGAGTGTGTGG
TGTTGTGTGGAGAAACGGGCAGTGGTAAAACCACACAGGT
GCCTCAGTTTCTGTATGAGGCCGGATTCGCCAGCTCTGGT
GGGATTATTGGTGTGACGGAGCCCAGGAGAGTAGCGGCGA
TCAGCATGTCTCACCGTGTAGCCACTGAGATGAACTTGTC
CAGCGGGGTGGTGTCTTATCAGATCAGGTACGAGGGGAAT
GTGACAGAAAACACAAAGATCAAGGTTATGACAGACGGTG
TACTGCTGAAAGAAATTCAGAGGGATTTCCTGCTGCAGAA
GTACAGTGTGATCATCATAGACGAGGCTCATGAGCGCAGC
GTTTACACTGATATCCTCATCGGCCTCCTCTCTCGCATCG
TTCCCCTCCGCAACAAGAAAGGTTTACCCATGAAGCTGAT
CATCATGTCGGCGACGCTGCGTGTGGAGGATTTCACTGAG
AACAAGAGACTCTTCAGCTCTCCTCCACCCGTCATCAAGG
TGGAGGCCCGTCAGTTTGCGGTCACTGTTCATTTTAATAA
GCGCACACCAATGGACGACTACACTGGAGAAACTTTCCGG
AAGATCTGCAAGATTCACCGCATGCTGCCGCCAGGTGGCA
TTCTGGTGTTTCTGACGGGTCAAGCTGAGGTTCATTCTGT
GTGTCGGAGGCTGAGAAAAGCTTTCCCTTATAAACCAAAC
CGAGAGCACACAGATATGATGGAAACAGAAGAAGATCTGA
AGAAGTCAAAACGAGCAAAGAAGAAGAATGTGTCTTTACC
GAGGATCAATCTGGATAATTACTCTGCTCTGCCTGTGGAC
GAGGGTGATGAAGACCGTCAGGCAGGCATTGATGAAGATG
ATGGTGAGGGTTCAGACCTGGAGCTGGAGTTGGGGGATCA
TCCAGACACTGATCACGAGGAGAAGGCCGATCCGTCCATC
CCACTGTATGTGCTTCCGCTTTACTCTCTGCTAGCACCTG
AGCAGCAGGCCAAGGTTTTCCGTCCTCCTCCTGCTGGATC
TCGTCTGTGTGTCGTCGCGACTAACGTTGCAGAAACATCT
TTGACAATCCCCGGCATCAAGTATGTTGTGGACTGCGGTC
GAGTAAAGAAGAGGTTTTACGACAGGGTGACCGGCGTCTC
CTCTTTTAAGGTCACGTGGATCTCACAGGCCTCAGCCAAT
CAGAGGGCAGGAAGGGCGGGAAGAACCGAGCCGGGTCACT
GCTATAGGCTGTACTCGTCTGCTGTGTTCGGAGATTTCAG
TTTGTTTTCGGAGGCTGAAATCACACGGCGTCCTGTCGAA
GATCTCGTTCTTCAGATGAAAGATCTCAACATTGAGAAGG
TTGTCAATTTCCCGTTTCCCACTCCTCCATCTTCTGAGGC
TCTGATTGCTGCTGAAGAGCTTCTAATCTCGCTGGGAGCG
CTGGAGAAACCGGCTCGACACGGACGTCTGAGTGAGATGG
AGAAGGCGCGTCTGTCGTGTCCCATCAGTCCCCTGGGTCG
AGCGATGGCTGCGTTCCCTGTAGCGCCACGTTATGCTAAG
ATGCTAGCGCTGGGCCGCCAGCAGGGCTGTATGCAATACA
TCATCACCATCGTATCCGCCATGACCGTCAGAGAGATCTT
CGAGGATTATGACAGGCCTGCAGGCAGTGAGGAGGAGAAC
GTGAAGATGAGCGGGAAAAAGGCCAGATCAGTTCAGATGA
GGAGGTTATGGGCAGGACAAGGAGCGTCTCTTCTGCTCGG
AGATCTGATGGTTCTGCTCGGAGCTGTTGGTGCTTGTGAA
TTTGCGGGTCTTACTCCTCAGTTTTGTGAGGAAAACGGCC
TTCGGTTCAAAGCAATGCTGGAAATCCGAAGATTACGAGG
ACAGCTGACTAATGCAGTGAATGCTGTGTGTGCTGACGCT
GATGTTTATGTGGATAATAAGATGGCTCCTCCGACAGAGG
CTCAGGTGTTGTGTTTGCGGCAGATCGTGTTGGCTGGTTT
AGGAGATCACATCGCCAGACGAGTGCAGGCCGAGGAGCTG
CTCGACCCCAAGTGGAGAAATGCATATAAGACTCCTCTGC
TGGATGATCCAGTGTTCATTCATCCGTCATCTGCTCTTCA
CAAAACACTTCCCGAGTTTGTGGTTTATCAGGAGATCATG
GAGACCACCAAGATGTACATGAGAGGTGTTTGTGCTGTTC
AAGATGATTGGATTCCCAAGCTCCTCCCACAATACTGTCA
CTTCAGTGCTCCAGAAGAAAGCCCCGCCCCACGGTTCTGT
CCTCTGATTGGCCGAGTGAAGTGTCATCAGCAGAGCACCT
TCTTCAGAGTCAGTTGGAAACTTCCTGCCATTGAGATGGA
TTACCCAGAGGGCCTTGAGCGTTACAAACTGTTTGCAAAG
TTTTTCCTGGAGGGCCAGGTTTGTCCCAAGATTCAGAAGT
TCAGCTCTTGTTTACTGTCGTCACCCTCAACTATGCTGAA
GACGTGGGCCAAGCTGCAGCCACGGACTGAAGTTCTTCTG
ACAGCGCTGGTTTCAGAGAAAGCAGACAACAGAACGTCTT
TAGAAGCTGCGTGGAGGAAAAACGAAAAATATCTGCTGTC
AGCGTATTGTCAGTGGATCCCAGAGTCTCTTCATGAAGAA
GTCAGTAAAATCTGGCCGCCGATCGGACAAGCAGACCCTC
GGTGACCTCTGACCTTCTAAACCTAGACTTTTAATCCTGA
ATCCGAGCAGTAAGACTTACAGCTCAAGAACAGAATCATT
CTCTGGCCAACTTCCAGCATAAAACCATGTTGCCTGAAAA
CCTTGACTTTTGTAAACACGTCTCCACACACCCTGACACC
AAAACAAATAAATTCATCGTCTTTTTTTAACGAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dhx37-201 Contained in:
OTHER dhx37-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039267 (1)
  • Ensembl_Trans:ENSDART00000090731 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC133160 (1) 3737bp
    CITATIONS (2)