ZFIN ID: ZDB-TSCRIPT-090929-1955
Transcript Name: he1.2-201
Previous Name: he1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000011351 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000011351|OTTDARG00000009892|ZDB-GENE-030131-2100 he1b|OTTDARP00000009778 CH211-246M6.8-001 LG_ BX649296.3 Danio rerio protein_coding NOVEL, 980 bp
GACATCAGACCTTGGCACAGGAGCATCCTGAACATCTCTA
CACACTGAGGCAACATGGACATAAGAGCTTCCCTCTCCAT
TCTGCTTCTGCTCTTTGGCCTCTCCCAGGCATCTCCTCTC
AGGGAGTTTGAAGCCATTTTTGTATCAGAGCCTGAAACTG
TGGACATCACTACACAGATTTTGGAGACCAATAAGGGTTC
TTCTGAAGTCTTGTTTGAAGGAGATGTGGTGCTTCCCAAA
AACCGAAATGCTCTCATATGCGAGGACAAAAGCTGTTTCT
GGAAGAAAAATGCTAACAACATAGTGGAGGTCCCTTATGT
AGTGAGCGGTGAATTCTCCATAAATGACAAATCAGTAATT
GCGAATGCCATCTCCATCTTTCACGCCCAAACCTGCATTC
GCTTTGTGCCCAGATCAATTCAGGCCGACTACCTCAGTAT
TGAGAACAAAGATGGGTGTTACTCTGCTATTGGTAGAACT
GGTGGCAAACAGGTGGTCTCCCTCAACAGGAAAGGCTGTG
TGTACAGTGGCATTGCTCAGCATGAGCTCAATCATGCTCT
GGGCTTCTACCATGAGCAATCCAGGAGCGATCGTGACCAG
TACGTCAGGATCAACTGGAATAACATCTCTCCTGGAATGG
CTTACAACTTCCTGAAACAAAAAACCAATAACCAAAACAC
TCCATACGACTATGGCTCGCTCATGCACTATGGAAAAACG
GCCTTTGCCATCCAGCCCGGTCTGGAAACCATCACTCCCA
TTCCCGATGAAAACGTGCAGATCGGACAGAGGCAGGGGCT
GTCCAAAATTGACATCCTCAGGATCAATAAGCTGTATGGA
TGCTAAAAAATGATATGTGTTTGTGATGATAATTCAATAT
ATGAATAATGAAGTGAGGTGATGGTGATAAGGTGACTATA
CGAATTTTCAACATTTATGTTTTAACAGATGAAAATAAAA
TTTGTTTTGATTTGCTTCAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
he1.2-201 Contained in:
[BAC] CH211-246M6 (1)

Genome Resources: Vega_Trans:OTTDART00000011351 (1),  Ensembl_Trans:ENSDART00000018432 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CD777999 (1) 765 nt
GenBank:AI353719 (1) 600 nt
GenBank:CB363022 (1) 594 nt
GenBank:AL728921 (1) 560 nt
GenBank:CB359348 (1) 558 nt
GenBank:AL910299 (1) 539 nt
GenBank:CB364739 (1) 515 nt
GenBank:AL728293 (1) 449 nt
GenBank:AL723157 (1) 443 nt
CITATIONS (2)