Transcript

gabrr2a-201

ID
ZDB-TSCRIPT-090929-19480
Name
gabrr2a-201
Previous Names
  • gabrr2a-001
  • zgc:153417-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000039176 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000039176|OTTDARG00000028676|ZDB-GENE-060825-164 gabrr2a|OTTDARP00000031350 DKEY-219F18.1-001 LG_ CR759878.11 Danio rerio protein_coding KNOWN, 1623 bp
AGAGATGCGAGCTGCAGCGATTTGTGCGCCGACGACGGAA
AGATGCTGCCCTTCCCGAGCCGCCGCCGCCACCGCGTTCA
TGGATTAAGCAGGATTTCAGGACGCACCTGTAGATTTTCC
ACCGGCTCTGCATGATGCCTTATGCGAGACAGCTCCTGAT
TTTAGTGCTCTTCCTGGGCTCGTTTGGGGAATGCCGGAAT
AAACACGCCACGAGAGAGAGGAGGTGGACGGGAGCTGTGG
AAACTCAGAAGCATGGGACGTCGCTGGCGAAGAAGCCACC
GGATGTGACGAAATCCCGACGACTGAAAACAGAGCAGCTG
CTGAAAGTGGATGATCATGACTTCACTATGAGGCCTGCGT
TTGGAGGACTTCACCATGACATTATATCTGCGCCACTACT
GGAAGGATGAGCGCTTGTCCTTCACCAGCTCCACGAACAA
AAGCATGACTTTCGACGGCCGCTTGGTGAAGAAGATCTGG
GTTCCTGACGTCTTCTTCGTCCACTCCAAAAGATCTTTTA
TTCATGACACCACCACCGAAAACATCATGCTGAGAGTCTT
CCCTGACGGTCACGTTCTTTACAGCCTGAGGGTCACAGTT
ACAGCCGCCTGCAACATGGACTTCAGCCGCTTCCCCCTGG
ATTCACAGACCTGCTCTTTGGAGTTGGAGAGCTACGCCTA
CACGGATGAGGATCTGATGCTGTACTGGAAAAATGGAGAT
GAGTCTTTGAGTATAGATGAGAAAATCTCTCTGTCTCAGT
TCCTCATACAGAAGTTTCACACTACCTCTCGGCTGGCTTT
CTACAGCAGCACAGGATGGTACAACCGCCTGTATATAAAC
TTCACACTTCGCCGGCACATCTTCTTCTTCCTGCTGCAGA
CTTATTTTCCCGCCACGCTGATGGTGATGCTGTCATGGGT
GTCGTTCTGGATTGATCGCAGAGCCGTTCCAGCAAGAGTT
TCATTAGGCATCACCACCGTGCTCACCATGTCCACCATCA
TCACTGGAGTGAACGCCTCCATGCCCAGAGTCTCCTACAT
CAAAGCTGTGGACATTTACCTGTGGGTCAGTTTCGTGTTT
GTGTTCCTCTCTGTTCTGGAGTATGCAGCGGTCAACTATC
TGACCACGGTCCAGGAGAGGAGAGAGCGCAAACTTCGAGA
TCGAGCTGTTAGAGAGCAGTCTCTGCCCTGCACCTGCGGT
ATGTCCCACACCAGGACCATGATGTTGGATGGGACCTACA
GCGAGGCCGACACCAACAGTCTGGCTGGTTACACAGAGGC
TCCGATGGTACACGAAGAGGTAGTACCGGAGAAACAGGAG
CATATGGTGGTCCACTTGTCCGTGAGCAGTGAGTCCACCA
ACACCAAGAAGAAGGGCATCCGCGCCTTACGCATCATGCA
GAACACACACGCCATTGATAAATACTCCAGAATGATCTTT
CCCGGAGCTTATATAATTTTCAACCTTATTTACTGGTCGG
TGTACTGCTGATCGTTCTCATCTTGCACTCTATTGGAGGA
TTTGTGACCATCCGGCTGACTTTTTCTTCATTTTTTTGAC
GCACATCAGGCTCGTTCGATACCAAACTGTGCTTATCTTT
TTCGCTTGTCATACGCAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations