Transcript

tecpr2-202

ID
ZDB-TSCRIPT-090929-1948
Name
tecpr2-202
Previous Names
  • tecpr2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000011321 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000011321|OTTDARG00000009862|ZDB-GENE-060503-358 tecpr2|OTTDARP00000009748 tecpr2-001 LG_ AL845481.5 Danio rerio protein_coding KNOWN, 5257 bp
GTCGCTGGCGTCACGTTTCTGTTTCAACCCAAACAGAGCG
AAGAAAACACACGAGCCTGTCAACAAGAGAGCGGTCTGTC
AGCGGAAGCAGCAAAAATGTCAACAGATAGCCTTTTTATT
AACTATAAAACCCTGTAGGCTTCAGAATCAATGTAAACGT
TTCCCGCTGATTTGCGCAGCATTGGGAGCACAGATCCACG
GGTGATCATGGCCACCAATCCAGCAGCGCTGCCCTTGAGG
GAGTTCTGCCCGCTCTACTATCTTCTCAATGCCATCCCTG
CTAAAGTCCAGAAAGGTTTCCGTTCAGTGCTGGTCTACTT
GACTGCACTGGACAGCAACAGTGATTATATAGCCATTGGC
AGCAGCATCGGCATGCTGTACCTCTACTGCAGAAGAGTAA
GTCAGATGAACAAATACAATTTAGAGGGCAAATGTGAGGC
TATAACTGCAGTGAAGTTGCTGAGTTGTTTTGATGATCTT
GTGGCTGTTGGGACAGCATCAGGCCGGGTTGCTTTCTTTC
AGCTTGTGTCACCATTGCCTGGAAGAAATAAACAGCTGAG
AAGGTTTGATGTGGTGGGTTTGCACAAAAGCACAATTACT
GCATTAGCGTGGAGTGCTAATGGCATGAAACTCTTCTCTG
GTGATGATAAAGGGAAGGTGGTGTACTCTGCTGTGGACCT
GGACCAAGGAGTCTGTAATCCAGTGGTCCTCTTCGAAGAG
CCTTCAGCAATAGTACAGTTAGAATATAGTCAAAAGGTAC
TTCTGGTTTCATCCTATCAACGCTCAATGCTTTTCTACAC
ACAAGAGCAGTCGCATCAGCAGCTGGGCAGTAAACCACGT
AAAAGCAATGGCAAGTTTGGAGCCTGCTTCCAGCCAGCTC
TGTGCAAGCAGAGTGATCTGGTGGTTTATGCAGCGAGGCC
GGGGTTACGTCTGTGGAGGACAGATGTGCGAGGACGTGTC
GGGGAGACTCATGTCTTAAAGCCCCTTTTTAATCAAGATG
TACCTCACTTTGAGCTGTTCCCACGCTCAGGTCCCACTGG
TGGATACAGACCTTCAGAAAGACAGTTAGGAATGATCAGC
TGCTTCCTGAAGGAGGGCTGGGTCCTCAGCTGGAACGAAT
ATAGTGTTTATGTTGTGGACTGCACCAATCAGGTCATCAT
TGGAGGACTGGAAAGCAGCGGAGATATAGTGTCTGTGTCA
TGCACTGAGAATGAAATTTTCATTCTGAAAGGAGACCGGG
ACATTTTGAGGATCTCAAATTGCCCTGAGGGATTGGTTTC
CAACTTATCAGACCACTCCTACCGTTTTACATCTCCTCTT
TCCCCTCCCACGATTTTGCTGCCTCCTAATGGGGCTGTGG
AAACCGCTCAACCAATCAGAACTATGCCTATCATCACGGA
GCAGGACACTCAGGCCAGTCCCAGCTCAGAAGAGGTGCAT
GATGGGGTAGAGGAGTCAGAGGAGGTGCAGGAAGAGCAGC
ATCTTGAGGAGTTCAGTCATGCGGTTGAGGCTCTGGAAGT
GGCAGAGGACTTGGAGCAGCAGCGGGCCAGTCTAGGTACA
GTAGAGTCCCGCAGCCGCAGCAGCTCTATCACTTCATGGG
ACAGTGCGCAGGGCATGTTCACCACCACTGAGGCCTCTGC
TTCAGAGCTCTCCTCCAGCAGATATAGCACCATCACCCAG
GAAGACTTCCAGCAGGAGCTTGTGGTCAAGGCCATCAAGC
TGAAGAAGAAAGGCAAGAGGAGACGACAAGAGAGTGGGAA
TCGCATGAACGAGCGCAGCAGTTGGTCGGAGAGCATTTTC
AGCCAGGACGGTGCAGGCAGTGACGTTCTGAACACACCCA
TGAGTGAACCACCTTCTGATCACACCAGCCTCCTTTGCAG
CAGCCTTGACCTGGATGGAGAATACCACAGTTCAGATGCC
TTTCCCATTCAGAGCCCATCAGAGCCCTTGCTGAACCAAG
AGCCATGTCTGGTTGCAGTTAACCAAGCAGCACAGACCTC
ACCACCTTGCCCCGCGTCTCTGACACTAGACATGGAGTGT
CAGTTGTACAGTGAAAATGTGTTTGCTGAAAATGAGCAAA
TCGCAGCTACACCTGATGTAGACATGCTGCTGGAATGTAC
CTTCTCGTACATGCAGGCATCTGACGAGCAGGACATCATG
AAGAAATATGTGAAGGAGCACAAAGACGTCCTGGAGGATT
CAGAGGAACATTTTAAGCAGAGTTTACATGAGGACTTTAA
TTTGGACTTGTCTTATGATCCCATTAGGCCGCTGGGTTAC
TCCCCTGAGCCTGAGCCATCGCCATCTAGTGACGAGGAGG
ACATCTATGCTCATGGAGTTCCATCCAGTGCAAGTCTTGG
GGATGGACTGAATGCTCTGAGCTTGCAGAGCTCATCTGCT
GAGCAGAAGGAGGATGAAGAGACACAGCTCCTCAAAGCTG
ACCAGTTGGCTGAAAGTTGGATGGGTTATAGTGGGCCTGG
CTGTGGCATCCTCAGTCTAGTGGTGACTGATAGGTACATC
TGGTGTCTGGACTTTAAAGGAGGCCTTTTCTGTAGTGGTC
TTTCTAACGGTGGCTTGAACTGGCAGAAATTTGAGGAGAA
TGTCCATCAGGTTGCTCTGTCTCCATCAGGCTCATTGTTG
TGGAAGGTGGAGCAGAAGACCATGACTGCGTACGCTTGTG
GGAAAGTGACAATCAAGGGAAAGAGACACTGGTACAAAGC
TCTGGATGACACCGCATTCGTGGCACTTGGTGATGACACT
GCCTGGATTATTCGTACTAATGGAGACCTGTACATACAGA
CAGGGCTGAGTGCGGACAGGCCATGTGCGAGGTCAGTGAA
GGTGGACTGTCCGTGTCCCATGGCACAGATGGCAGCACGG
GGCGGTGTGGTGTGGGCACTGAGCGAGCAGAGGGGTGTGT
TTTACAGAGAGGGTCTCAACAGCTACTGTGCAGAGGGGGA
GCACTGGAAGTATGACACTGTCAGTGAGAGCCAAGGTCTG
GAGCCTATCTGTATTGCTCTGGGTGAGAACAACACTGTCT
GGGCTTTGGACACCAGTGGAAACCTATGGTTCAGGACAGG
GGTGACTGCTAAAAAACCCCAGGGTGAAGATGACCACTGG
TGGCAGGTGAGCATCACAGACTATGTGGTGTTTGATCAGG
GCAGTCTTTTCCAGACTCTGATCCAGGCCACTCAGACTGT
GGCCACTGTCACCAGAGCTCCAGTAGAGCGGGTAGCTGAA
CGTCTGCGTGTGGCCTTCCTCTCCCAGCACTCCCAGTGCC
AACCCAGCCTTATCAGTGTCAACATTAGTGGTGTCTGGAT
TGCGTCTGGACGTAATGAGTTCCACGTTGCCAAAGGCAGC
CTTATTGGGACATATTGGAGGAGCACTGTACCCAGAGGAA
CTGCCTCTGCCACTAAATGGGCCTTTGTGTTCTCCTCTGC
TGTTCCAGCCAAAGAGGGCAGTTTCCTTTGGTTAGGTCAG
AGCAGGAAAGACCTGTTCTGTATTTGGGACCAGGACCTTC
AGATGCGACCCTTTACTATTCAGTTTCCCCCAGACGTGGA
GATGATGCAGCTCTCGGCCTGTCGTGATGCATTGTGGGGT
TTAGATCACTACGGTCGTGTCCACATTCGCACTTTATCAG
CCAGCTGCTCTACAGGAATGCACTGGTCATTGCTGGACCT
CAGTCAGCTTGGTCATGTGAGGTTTCTCAGTTTGTCGTGT
GGCAGTCAGAACGTTTGGGCATGTGATACTAATGGAATGG
TGTATTTTCGGGTTGGAACTCAACCTTTGAACCCCAGCAT
GATGCTTCCAGCCTGGATCTGCATTGAATCTCCTGAACAG
CCTGCTGGACATTATTTGGTGAAGATTCAGACCAGTCCTA
ATGACCGCATGCTGTGGGCACTGGACAACAGAGGCAATGT
GCTCGTACGTATCGGCATCACTGAGGAGATGCCTGTTGGG
ACGGCCTGGGAGCACATTCCAGGACTTCAGGCATGTCAGT
TGGTTCTGAGCATGAGGACCGCTTGGGTTCGTCTTGCTAA
TGGGCAAGTGGCTCGTCGATACGGAATTACAGAGAAAAAC
CCTGCTGGAGATTACTGGAAGAAGATCCCTGGACTGGCCA
GCTGCCTCGCAGTGACCCCGATGGATGAACTGTGGGCTGT
TTCTCCAACTGGAGCTTTGAATCAGCGGCTCACCAAGACT
CTGCAAAACTATAGGAGCAAAAACCATGTCAATGCAGGAT
CTCTGAGTGGAGAAGAGCTGGAGGAAGAGTGGGAGGTGAT
TTAAATGCCACAAATTGTGTTGAAGCAACCCAGAAATCAC
TGTTATGTGACATTTCTTTCTAGGCACTTTACTCATTTCT
GCTTAAAAGAGTAGTTCAACTGAAAAAAAAAAACTATGGA
AAAGCTGTCATCATTTACTCACCCTCGTGTTCTTTAAATC
CTTAAGAGTAGACTGCGCTCTGTTAAATCTATGTGAGGTG
TGTTACTTGGAAAAAAAGTGAAAAAAAACGTGCACCTTGT
GACCGAAAAATGTTTATCTATTTTGTTTAATCTAGCACGA
TATTTCATTTTAAAATGTATATTCACTCTTAGATCTTTTA
TTTTTAACTTTATTAATCTGTGGAGACTCCGTTTATACAT
TACCATTCAAAATTGGGGTCACTAAGTTTTTTTTTGTTTG
TTTTCTTAAAGAAATTAGCTATTTTAATTAACAAGGATGC
ATAAAGTTGATCAAAATTAACAGTTTTACAAGTAAATGTT
TCGTTTTAGTTGTTAGTAATCCTGAAATCAGCCGTTTTAA
TAAAAATATCAAGCAGCACAGGTGTTTTTAACCTTTATTA
TTATAAGAAGAACTGTTTAGTAATGTTTCACTCAGCTTAT
TAGAGGGATACATGATTTCTGAATAGTTATAAAAACTCAA
TTGGCAGTGAACATTTGCAAATTCTAGATGATTAAATTAA
AAGTAGTGCTGTACATCTTATCAAAATCAGTTTAATATTA
ATCAGATTTGAGAAATTGTAAAAAGTTTGAACCAAATTAA
CCGTTATGACTGTTTTATGGCCATCAGAAAACATCAAGAA
TTTGAAGCATTTTTACAACAGCCTGTCAAAATATAAGTTT
GGTTTAATCTGATGAAATAGGGACAGAAATATATTGCTAT
TTTACAGTAAAATTATCTTTTCAAAGTTGTAAAAACGGGG
TGACACGGTGGCTTAGTGGTTAGCACTGTCGCCTCACAGC
AAGAAAGTCGCTGGTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations