ZFIN ID: ZDB-TSCRIPT-090929-19422
Transcript Name: cntn3a.1-002
Previous Name: si:ch211-247h9.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039118 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039118|OTTDARG00000028645|ZDB-GENE-081030-10 cntn3a.1|no_translation CH211-247H9.1-002 LG_none CR394523.19,CR394557.6 Danio rerio protein_coding NOVEL, 610 bp
GAACCCACCAAACCCTCACAAAAAATCAGGACCAAGGACA
CAATGCCAAGGATAACCCCAGCCAGAGTCAGTGGAGGAGG
TGGCAGCCGCTCTGAGCTCGTCATCACTTGGGAGCCAGTC
CCAGAAGAGCAACAAGCTGGTCCAGGGTTCGGCTATGTGG
TCGCTTTTCGCCCTCTTGGTGGCCAAAACTGGATGCAGGC
GGCAGTTACATCTCCTGATGCATCACGATACATCTTCAAA
AATGACAGCATCCCTCCTTTTTCTCCATTTCATGTCAAAG
TGGGAGTTTACAACAACAAAGGAGAAGGTCCTTTTGGACC
TGTCACCACTATATACTCTGCAGAAGAAGGTACTATACTG
TAAAAACAATGCACAAGCTCCCATTTTCGGTACAGTATAA
ACTCAGTGCTACAGATATTTATTTTGTTTAATGTAAAGAT
ATATCTAAGCTGCTGGTCAAAAGTAGTCAATTATGCTCAG
AGTGACTGCATCTATTTGAAGAATAATAGAGTAAAGAGTT
TGTATAAATTCAACTTAACAAAATCACTGAACATGTACAA
AATGGTCTATTTTTAATATGTTAGTTTTCAAACTTTCTAT
TAAGCAAAAA

cntn3a.1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cntn3a.1-202 (1)    Ensembl 3389
ncRNA cntn3a.1-002 610
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cntn3a.1-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000039118 (1),  Ensembl_Trans:ENSDART00000146961 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI534088 (1) 609 nt
CITATIONS (2)