ZFIN ID: ZDB-TSCRIPT-090929-19317
Transcript Name: myca-201
Previous Name: myca-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000039011 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000039011|OTTDARG00000028601|ZDB-GENE-990415-162 myca|OTTDARP00000031212 myca-001 LG_ CT573344.8 Danio rerio protein_coding KNOWN, 1864 bp
TCAGACTATCAGTCTGTCCAGCATCTGAGAGCTGCACGAG
CGCGCAGGGTTGTTTATATTTTCCATCACTTTCCTTCCCA
CTTGACCGTGACTCTGACGCCACTTATGCTGCAAGTGACC
GGAGCAAAAACTGTTGGATTTTACTTCTCGCTCCTTCTTT
TTTGCTCTCTTTTCATTGCATTGCGTCTCGAAAGAAACAA
TTCTGGAACGGCATTCGTTAAATACAAGTGTCAAAATGCT
GGTGAGTGCGAGTTTGGCGTGTAAAAACTACGATTACGAC
TACGACTCCATCCAGCCCTACTTCTACTTCGACAACGACG
ATGAGGATTTTTATCACCATCAGCAAGGACAGACTCAACC
TTCAGCCCCCAGCGAGGACATTTGGAAGAAATTCGAACTG
CTGCCCACACCGCCCCTCTCGCCCAGCCGGAGACAGTCGC
TCTCCACCGCGGAACAGCTGGAGATGGTCAGCGAGTTCCT
GGGAGACGACGTGGTCAGCCAGAGCTTCATCTGCGATGAT
GCGGACTACTCCCAGTCCTTCATCAAGTCCATCATCATCC
AGGACTGCATGTGGAGCGGCTTTTCTGCCGCTGCCAAGTT
GGAGAAAGTGGTTTCAGAGAGACTGGCGTCTTTGCACGCG
GAAAGGAAGGAACTGATGTCTGACAGCAACTCAAATCGAC
TAAACGCGAGCTATTTGCAGGATCTGAGCACCTCTGCATC
AGAATGCATCGATCCCTCTGTGGTCTTCCCATATCCTCTG
ACAGAGTGTGGGAAAGCCGGCAAGGTTGCATCACCACAGC
CCATGCTGGTCCTGGACACTCCACCTAACAGCTCCAGCAG
CAGTGGCAGCGATTCAGAAGATGAAGAAGAAGAGGATGAG
GAGGAGGAAGAAGAAGAGGAGGAGGAAGAAGAGGAGGAAG
AGGAGGAAGAAATTGATGTGGTGACTGTGGAAAAGCGACA
GAAAAGGCACGAGACGGATGCTTCAGAGTCGAGGTACCCC
AGTCCCCTAGTTTTGAAGCGCTGTCACGTCTCCACCCACC
AGCACAACTACGCCGCCCATCCGTCAACGCGGCATGACCA
GCCTGCTGTCAAGAGGCTACGACTTGAGGCTAGCAACAAT
CACAGCATCAACAGCAGCAGCAGCAGCAACAGGCATGTGA
AGCAGCGCAAGTGTGCGAGTCCTCGGACATCGGATTCTGA
GGACAATGACAAACGCAGGACTCACAATGTGCTGGAGCGA
CAGCGCAGGAATGAACTCAAACTCAGCTTTTTCGCGCTAC
GGGATGAGATCCCTGAGGTCGCGAATAACGAGAAAGCTGC
TAAAGTGGTTATCCTAAAGAAGGCGACAGAGTGCATCCAC
AGCATGCAGTTGGACGAGCAGAGGCTGCTGTCCATCAAAG
AACAGCTGAGGCGAAAGAGCGAACAGTTAAAACACAGGCT
TCAGCAGCTGCGGAGTTCACATTAATGAATCTGTGTCACA
AGCGAAAAGACTTTCCAAGAACTCCCACCCCCTGCTTTTT
TATGCAAGACTGTTGCTGTGTATAGTTTGAACGTTGCATG
TCAAATGCATTTTTTTTTTTCCTTTTGAATATTGTCAACT
TTTTTCATGTTTGAAACTGCCAGTTTGGTTGGAAACTACA
AGTTTGTTCAAGTAATTTGTATTTAAGGGATTTATTTTTA
TTAATAAAATAAGAAAAATATAGGGCTGCGCAGCCCTAGA
TTAAAATGTTTTTGTAAGTTTTTGTATATAACGAATTAAT
ATTTCCTAAGAAAAATATTTTTGAACCTGTATTAGCTATG
TGTTCTCATAAACCATATTCGTTTTCAATGTTTTCACTCA
ATCATAAAGGAATTTCTTTCTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
myca-201 Contained in:
OTHER myca-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000039011 (1)
  • Ensembl_Trans:ENSDART00000111014 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053281 (1) 1869bp
    GenBank:EH580213 (1) 984bp
    CITATIONS (2)