Transcript

chia.4-002

ID
ZDB-TSCRIPT-090929-19199
Name
chia.4-002
Previous Names
  • zgc:63792-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038864 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038864|OTTDARG00000028505|ZDB-GENE-030131-9279 chia.4|no_translation CH73-390P7.1-002 LG_ CU234171.6 Danio rerio protein_coding KNOWN, 775 bp
CAGACTCATGCTCACTGCTGCAGTGGCTGCTAGGAAAGGA
ATCATTGATGCTGGTTATGAAATTGCAGAAGTTAGCAAGT
ATTTGGATTTCATCAATATCATGACCTATGATTTCCACGG
CTCATGGGAGAACGTTACTGGACACAACAGTCCTCTGTAC
AGAGACTCCAGAGACACAGGAGACCAAATCTACTACAATA
CTGACTTTGCAATGACCTACTGGAGAGATCAGGGCGCTCC
TGTGGAGAAGCTGAGGATGGGCTTTGCAGCATATGGAAGG
ACGTTTTGCTTGTCATCTGCAGTCAATGGACTTGGAGCTC
CAGTTAGTGGTCCAGCATCAGCTGGAACATACACCAGAGA
AGCTGGATACTGGTCCTATTATGAGATCTGTACTTTCCTC
CAAAGAGCCAGTGTGGAACAAATTGCTGATCAGAAAGTTC
CTTATGCCACCGAAGGACTGAACTGGGTGGGATTTGATGA
CCAGAAAAGCTACGAGACAAAGGTGAGTATTCCAAAGTAT
AGAACAAATGTTCTCATGCTTTGAGTAACTAGGTCTGGTC
TGTTTTAGGTGGACTACCTGAAGGAGAAAGGCTTTGGAGG
AGCTTTTGTCTGGTCTCTGGATCTTGATGACTTCAGTGGT
CAGTTCTGTGGGCAGGGCAAATACCCTCTTATTGGACACC
TCCACACGCTGCTTAATATCAGCAACACTGAGTTCAGACA
CCTTCCAAAAACAATCAAGTCTGGTGGGGCATCGGCAACA
GGAAACATTGTTACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations