Transcript

chia.4-201

ID
ZDB-TSCRIPT-090929-19198
Name
chia.4-201
Previous Names
  • chia.4-001
  • zgc:63792-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038863 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038863|OTTDARG00000028505|ZDB-GENE-030131-9279 chia.4|OTTDARP00000031110 CH73-390P7.1-001 LG_ CU234171.6 Danio rerio protein_coding KNOWN, 2223 bp
GTCTTCACTTGTAAGTGACTACTGTGTTCCTGTTCAATTG
TTAAAATTTGATTAATAAATTGAAACCTTTTATATACGGT
TATCAAAGCATTTGTTAAGAAGATTATGACAGTAATAATG
ACTAGGCAAATTTTATATAAAAAAAGATAAAATAAAAAAG
TCTGTCAGATACTTTCCTTATATTTTCAGGTAGACAACAG
GGATCTAACAGTGAGGGAAAAACAAAGGAGACTGGAGACC
TGAGCGACAGAACAGGTCTTGGTTAATCATCACGTATAGG
AGTGAATTTAGTGTGTGTGGGTTAAAAGCTCATACGGCTT
ACTCCTGACTGATATAAACATCATTCGAAGATGACCGGAT
TCATTTTTGTAGCTGGCATTTCCTTGGCATTGTGCCAATG
TGGATTGGCGTCCCAACTTGCATGTTACTTCGCCAACTGG
TCTCAGTACAGACCTGATGTTGGCAAGTACATGCCATCTA
GTGTGGATCCACATCTTTGCACTCATTTAATTTATGCATT
CTCTGTTATTAATATTAAAAATAAATTGGCAACCTCCGAA
TGGAATGATGAGACTCTTTACCAGTCTTTCAATGCGCTAA
AACAAAGCAACCCCAACCTGAAAACTCTGTTGGCTGTCGG
CACATTGAACTTGGGCTCAACTCAATTCAGCAGAATGGTG
TCCACGCCACAAAAGAGACGGACATTTATTGAGTCCAGTA
TCAAATTCCTGAGGACCCATGGATTCGATGGTCTGGATCT
GGACTGGGAGTATCCTGGTTCTGGTGAAAGTCCTCCAGAA
GACAAGCATAGATTCACTTTGCTCTGTAAGGAGCTTTTAA
AAGCTTACCAGGCAGAGAGTAAAGCTACTAGACGCCCCAG
ACTCATGCTCACTGCTGCAGTGGCTGCTAGGAAAGGAATC
ATTGATGCTGGTTATGAAATTGCAGAAGTTAGCAAGTATT
TGGATTTCATCAATATCATGACCTATGATTTCCACGGCTC
ATGGGAGAACGTTACTGGACACAACAGTCCTCTGTACAGA
GACTCCAGAGACACAGGAGACCAAATCTACTACAATACTG
ACTTTGCAATGACCTACTGGAGAGATCAGGGCGCTCCTGT
GGAGAAGCTGAGGATGGGCTTTGCAGCATATGGAAGGACG
TTTTGCTTGTCATCTGCAGTCAATGGACTTGGAGCTCCAG
TTAGTGGTCCAGCATCAGCTGGAACATACACCAGAGAAGC
TGGATACTGGTCCTATTATGAGATCTGTACTTTCCTCCAA
AGAGCCAGTGTGGAACAAATTGCTGATCAGAAAGTTCCTT
ATGCCACCGAAGGACTGAACTGGGTGGGATTTGATGACCA
GAAAAGCTACGAGACAAAGGTGGACTACCTGAAGGAGAAA
GGCTTTGGAGGAGCTTTTGTCTGGTCTCTGGATCTTGATG
ACTTCAGTGGTCAGTTCTGTGGGCAGGGCAAATACCCTCT
TATTGGACACCTCCACACGCTGCTTAATATCAGCAACACT
GAGTTCAGACACCTTCCAAAAACAATCAAGTCTGGTGGGG
CATCGGCAACAGGAAACATTGTTACCACAACACCTATTGT
AAAGACTGTTACATCAGGATCAGACTTCTGTGCGGGCGGA
TTAGTGGGCATCTTTGCAAATCCAGATAATCCCATGACAT
TCATTCAGTGTGCCAATGGCAGGACCTTCATACAGAATTG
TCCTGCAAAGACTGTCTTTGATCCCGACTGCTCATGCTGT
AACTGGCCAAAGAATTAACATCTGTTAATCCCACAGTTGG
ACGCGAAGACTTTCAAATTATACGTTAAGTCCAATTACAC
AAAGGTGTTTCATGTAACAGATTTCATGTGTAAATCTGTG
TGCCACAAGTTTTAACCCACAAACATCTTTGTATTTTGAC
TTCTGTTGTACCAAAGAGTTTTTCTACACTCCTTGTACAA
ACTTACCTCTATGTGCATCTGTTATTACTGTAGCTTGTGT
GCATTCTAGACCAGGGGTGTTGGAGTTTATAGTTTCAGCA
CTTACATGTGGCTTTCAAACAAGCCTGATTAACTTTTAAT
TTGATCAGGAGTAGTTAGCTAAGGTTTAAGTTGTGCAGGG
CTGTAGTACAACTGGTTTCTAGAGAGTCAAGGAAAAATTC
TCTTGTGAATCAATGCCCCTTATGCATAATTGCAACTTTT
AATAAAGAAATTGCAGAAAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations