Transcript

ctdspl2a-202

ID
ZDB-TSCRIPT-090929-19146
Name
ctdspl2a-202
Previous Names
  • ctdspl2a-002
  • zgc:154017-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038796 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038796|OTTDARG00000028476|ZDB-GENE-061013-647 ctdspl2a|OTTDARP00000031074 ctdspl2a-002 LG_ BX005048.9 Danio rerio protein_coding KNOWN, 478 bp
ACCGTGTCGTCGCGACCCCTGGCATTCTTACATGTGACTT
TTGGGACAATGAGGCTGAGAGTGCGTAAAGCATCTCAGCA
GCGGAGCGCCACCCCGTCCGCCCGGACCGTCAAGACCAAA
AGGAAGCACTCCGAGGTGGAGCACAGTTTGTCCACTGAAG
ACGCCAAGATGCAGAAGCGAGACACGGGCATTTTCTCCAC
CATCAAACGCTTCATCAGAGGCAACGCCGTCAAGGACTCA
TTGATCGATCTGTCTTTGTGTCAGGTGGAGCAGTGCACTC
CTGCGAAGAGAAGCCGTGTTGACTGTGATTCAGACAGTAA
TCTGATCACATCCACTCCGACCGGTGGAAACCTGCCCAGC
AGAGCAAACCCCAAAACCCGCAGGAAAGGCCCTGTCAATG
GAGATACCATGACAGGTCAGAATAAACCAGTAAAGCCCAA
TGGGAAGCTGGAGGTGCAGGCGGAGACTCCGAGCAGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations