Transcript

ctdspl2a-201

ID
ZDB-TSCRIPT-090929-19145
Name
ctdspl2a-201
Previous Names
  • ctdspl2a-001
  • zgc:154017-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038795 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038795|OTTDARG00000028476|ZDB-GENE-061013-647 ctdspl2a|OTTDARP00000031073 ctdspl2a-001 LG_ BX005048.9 Danio rerio protein_coding KNOWN, 2531 bp
GGGTTCTTCGCAAGAATCCCTCTGAGAGGAGGCGGGAAAT
GGCGTCCCGAGCAGCTGTAGCAGATCTATCTGTCGTTCTG
TGACTCACACTCAGCGGAGAAACTGACCGACAGACGCTGT
CGCGGGCCGCGGCCACTTCCACAACCACCTCTACACCGTG
TCGTCGCGACCCCTGGCATTCTTACATGTGACTTTTGGGA
CAATGAGGCTGAGAGTGCGTAAAGCATCTCAGCAGCGGAG
CGCCACCCCGTCCGCCCGGACCGTCAAGACCAAAAGGAAG
CACTCCGAGGTGGAGCACAGTTTGTCCACTGAAGACGCCA
AGATGCAGAAGCGAGACACGGGCATTTTCTCCACCATCAA
ACGCTTCATCAGAGGCAACGCCGTCAAGGTGGAGCAGTGC
ACTCCTGCGAAGAGAAGCCGTGTTGACTGTGATTCAGACA
GTAATCTGATCACATCCACTCCGACCGGTGGAAACCTGCC
CAGCAGAGCAAACCCCAAAACCCGCAGGAAAGGCCCTGTC
AATGGAGATACCATGACAGGTCAGAATAAACCAGTAAAGC
CCAATGGGAAGCTGGAGGTGCAGGCGGAGACTCCGAGCAG
TCCGCCTCGCACCACTCTCCTGGGCACCATCTTCTCTCCT
GTTTTTAGCTTCTTCTCGCCCGCCAACAAAAACGCTACGG
CAGGCTCCGATTCCCCAGGCCAGGCGGTGGAAGCTGAGGA
GATCGTGAAGCAGCTTGACATGGAGCAGCTTGAAGAAACC
CCGACCAGCACTACCACAGACGGCCGAGACCTGACCTTTG
ACCCTGCACTAAACCCCAGACCGCTGCCTCACATAGACAC
AACAGTAGAGGAAGGAGAGATCGTCACAGAGGCGGATATG
CCACCTCTGACTGCTGTAGGATCCAACAGCAATTACCCAG
ATGTCCCTCCATCACCTCCTGCAGAGGGGACTTATGAAGA
GGACTGGGAAGTTTTTGATCCTTATTTCTTTATCAAACAC
GTGCCACCGCTGACTGAAGAGCAGCTCACCCGTAAACCTG
CGCTGCCTCTGAAAACCAGGAGCACGCCCGAGTTCTCCCT
TGTTCTCGATCTAGATGAGACTTTGGTTCACTGCAGCCTC
AATGAACTGGAGGACGCAGCCTTGACCTTCCCTGTTCTTT
TTCAAGATGTCATTTACCAGGTTTACGTCCGGTTACGGCC
ATTCTTTAGAGAATTCCTGGAACGCATGTCTCAGATCTAT
GAGATTATTCTGTTTACTGCTTCCAAGAAGGTGTATGCTG
ACAAACTGCTGAACATCCTGGACCCTAAAAAACAGTTGGT
TAGGCACAGATTGTTTCGTGAGCACTGCGTGTGTGTTCAA
GGGAACTACATTAAGGACCTGAACATCCTCGGTCGAGATC
TTTCCAAGACTGTCATCATCGATAACTCCCCGCAGGCTTT
TGCCTACCAGCTTTCCAATGGGATCCCCATTGAGAGTTGG
TTCGTGGACAAGAATGACAATGAGCTCCTAAAGCTGGTGC
CGTTTTTGGAGAAGCTGGTGGAACTGAACGAGGATGTTCG
TCCATACATCAGAGAGCGATTTCGCCTGCATGACCTTTTA
CCCCCGGACTGAAGGTGGAAGCAAAACGAACACTTCTTGC
CAACCTGACTGTTTTCAAGCAGTGGGGAAATTCACACCAA
GGGGAGGGGAAAGGAGAACTTGCCACAAACTCTTTGCCAT
ACGGATTTAAACTGCAGACTTGCCCACATAGGGCGTCTTT
TATTCGGGACGGGAGGGGAGGGGAGGGGGGGTGTGTAGAC
AGATGTTTTAAAACAAATGACTCGATGTATGCATACGTTT
TCTATACACAAAAACACACACACACACACACACACGTTTA
TGGATCCGACAGCGAGGATCATTTTTTGATTGGTCGCCAG
TCTCGGAGTGAAGTTTATGCCTGATGGGGACTTTAATCGT
AAAGCGCTTTTGTGCAGAAGTGGACTTTCGTCACTCCTTT
TGGTGCTCAAAGGGACCCTCTGCCCTTCCAGGCCACTTCA
GCAAGAATAGAAATCTATAAAACACGGATATATACATTCA
ACTACGTGTGTATATGTGTATATATAACATTTGTACATAT
ATATTTTTTCCTGTCAAGTTTGTAAAACACAACTTGCCCT
TTGGTTTTAATCCATTATGCATTCCTCCTTCGTTTTCGTT
TCATAGATGAGCTGGCTTTTTATTCATTATCACTTTTTTT
ACTCTAGATTTTTCTGTATATTTAATGGCCTATCCGTTTC
GCTTTCGCTCTCTTATTCGCAATGACGTGTAATCGAATAT
CCGGTCATCATATTTGTAAATCCCGACTCTTTGATTCTCC
ATCTATAGTTGTGGCTTTCAGTTACTGACCGCTTCCTATC
ATTTATCCATGTCAGTCCTTAAAACTTGGGGAGTTTTAAC
TACTTCTTTTTTTTTATATACACGTATAGCTGAAATGTAA
AATACTGTATGTGCTTTAAATTGCTTTTCTGTGAAGAAGA
AGAAGAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations