ZFIN ID: ZDB-TSCRIPT-090929-19120
Transcript Name: commd4-003
Previous Name: zgc:153556-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038770 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038770|OTTDARG00000028466|ZDB-GENE-060929-600 commd4|no_translation DKEYP-73B11.4-003 LG_ CR391977.5 Danio rerio protein_coding KNOWN, 949 bp
AAAGCCGAAACCGAAGAAGAAGAGGACAAGCAGCTGACTG
CGATTGACACTATGAGGTTCCGATTTTGTGGCGATTTGGA
CTGTCCTGACTGGGTCCTTGCAGAAATTAGCACCTTAGCT
AGAATATCTAGCGTCAAGATGAAACTTCTATGCGTGCAAG
TTGTTAAAGATCTTCTTGATGAAGGCATTGACTATGACAA
AGTGTCAAAACTGACATCAGACGCCAAATTTGATAGTGGA
GATATCAAAGCCTGCATAGGTGTGCTGAGTTTTATTCTGT
CCAGTGCAGCGAAGCATGATGTGGACAGTGAATCCCTCTC
CAGTGAACTACAGCAGCTTGGCCTGCCTAAAGAGCACACC
ACAGGATTGTGTAAATCATATGAGGATAAGCATAGTGCTC
TTCAGGAAAAGCTGAGAGAGAGCAGCCTACGCTGTAAGTA
CTACCAAAAAAGATAAAATGATGCAGCCCAGACTACTTCT
TTAAATGCAATATTCTGTTCTGGTTTACATAATTTGTCAG
TGGGTCGTCTGCAAACAGTGAACTGGCGGGTTGATTACAC
CCTGAGTTCCAGTGAATTAAAGCAAGTGAATGAACCTACA
GTGCAGCTGAGACTTCAGGCTCAGGACCCCCTGACAGACT
CCTCAGAGACCACCGTTGTCTCCATCACTGCTGACAAGTT
CAGAGTACTGCTAACAGAACTCAAACAAGCTCAGAATATG
ATGAATGTGCTACAGTGAACCAGCTTTTTAAAACCGTATT
GCTGAATTAAACACTTGCCCAGATTCTGTCTGTACTGTGT
ATGTATAAATAATGTGATTTTATAAAAAGATAAATGTTTT
TCTAATGTAAAGTATTTTTCTCTCATAACTCAACCCTCTC
TCATAACAGCTATATATATTACTATGTGACTGTGTGCAAG
AAAATAAACGTTTGAACACAAAAATAAAA

commd4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA commd4-202 (1)    Ensembl 893
ncRNA commd4-002 (1)    Ensembl 853
commd4-003 949
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
commd4-003 Contained in:
[BAC] DKEYP-73B11 (1)

Genome Resources: Vega_Trans:OTTDART00000038770 (1),  Ensembl_Trans:ENSDART00000088950 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC124386 (1) 961 nt
CITATIONS (2)