ZFIN ID: ZDB-TSCRIPT-090929-19119
Transcript Name: commd4-002
Previous Name: zgc:153556-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038769 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038769|OTTDARG00000028466|ZDB-GENE-060929-600 commd4|no_translation DKEYP-73B11.4-002 LG_ CR391977.5 Danio rerio protein_coding KNOWN, 853 bp
GACACTATGGTATTTGTCTGTTATTAAACGATTATTGGTT
TATTCGAATTTCAAATATGATACAATTACATAAAACATTG
TTTTGAGAATTATTCTTTTTAATCCATTTTAATTTTGTGG
ATAGCCAACGCCAGACGCCCAAGCGTATTTAACGTTAAGA
TGTATACATTTAAGAATAAACTAACTTAACGTTATGTGTG
CAACTTGTATTACAGAGGTTCCGATTTTGTGGCGATTTGG
ACTGTCCTGACTGGGTCCTTGCAGAAATTAGCACCTTAGC
TAGAATATCTAGCGTCAAGATGAAACTTCTATGCGTGCAA
GTTGTTAAAGATCTTCTTGATGAAGGCATTGACTATGACA
AAGTGTCAAAACTGACATCAGACGCCAAATTTGATAGTGG
AGATATCAAAGCCTGCATAGGTGTGCTGAGTTTTATTCTG
TCCAGTGCAGCGAAGCATGATGTGGACAGTGAATCCCTCT
CCAGTGAACTACAGCAGCTTGGCCTGCCTAAAGAGCACAC
CACAGGATTGTGTAAATCATATGAGGATAAGCATAGTGCT
CTTCAGGAAAAGCTGAGAGAGAGCAGCCTACGCTTGGGTC
GTCTGCAAACAGTGAACTGGCGGGTTGATTACACCCTGAG
TTCCAGTGAATTAAAGCAAGTGAATGAACCTACAGTGCAG
CTGAGACTTCAGGCTCAGGACCCCCTGACAGACTCCTCAG
AGACCACCGTTGTCTCCATCACTGCTGACAAGTTCAGAGT
ACTGCTAACAGAACTCAAACAAGCTCAGAATATGATGAAT
GTGCTACAGTGAACCAGCTTTTTAAAACCGTATTGCTGAA
TTAAACACTTGCC

commd4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA commd4-202 (1)    Ensembl 893
ncRNA commd4-002 853
commd4-003 (1)    Ensembl 949
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
commd4-002 Contained in:
[BAC] DKEYP-73B11 (1)

Genome Resources: Vega_Trans:OTTDART00000038769 (1),  Ensembl_Trans:ENSDART00000140643 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH560641 (1) 977 nt
GenBank:EH539453 (1) 875 nt
GenBank:EH570725 (1) 872 nt
GenBank:EH549604 (1) 689 nt
CITATIONS (2)