Transcript

islr2-201

ID
ZDB-TSCRIPT-090929-19041
Name
islr2-201
Previous Names
  • islr2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038691 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038691|OTTDARG00000028423|ZDB-GENE-050320-95 islr2|OTTDARP00000030991 islr2-001 LG_ CR855275.7 Danio rerio protein_coding KNOWN, 3400 bp
CTGTCCAAACTCGAGCGCGAGGAGAAAACAGCCTCTGGAC
TGCTCAGCATCACACGGACACTAAAATGTATCATCTTCCA
TCTGCTAACCAAAACGGCAAGGATTTCCAGCGGGATATAA
ATGGCTACATGATGTTTTGGGTGAAAATTGACGTCTGATC
TTTAAATAGTATATTTCATCAAGTGTCGTGCTGACTGAAA
TCCGCGCGAGTGTTAGGAAAATCTTTCACAGGAGCTGAAA
ATGGCAACCAAATACCTGATGCTTATTGCCCTGGGGACTG
CATTGATTGGCAATGCACACTGTTGCCCCAAGCAGTGTGC
CTGCTCTGATAAATACAACCACCAGTTCGTAGACTGTGCC
TACAAAGACCTTGTGGAAGTACCTGTGGGTTTGCCGTCCA
ATGCAAGCACCCTGAGTCTTTCAGCGAACAAGATTAAAGT
GCTGAAATCCAAAACTTTTGTAAACGTGACCCAGGTGACC
TCTCTTTGGCTGGCTCACAATGAAATCATCACAGTCGAGA
GGGACACGTTGGCTCCATTGATTCAGCTGAAAAATTTGGA
TATTAGCAACAACAAAATTGTGCATTTTCCATGGGAGGAC
TTGGCCAATCTTGGTGCTTTGCAGTTGTTAAAGATGAACA
ATAATGAGATGGTCAGCATCCCTAAGAACGCCTTTTCAAA
CTTGAAAGACCTGCGTTCAATCCGTATTAACAATAACAAG
TTTACCACTATTGTGCAAGGAACATTTGATTCTTTGGCTG
CCATGTCCCATCTGCAAATCTTCCACAACCCCTTCATCTG
CTCCTGCAACCTTGAGTGGCTTAGGGACTGGATCCTCAAA
TCCTCAATCTCCATTCCTGAACAAAACAACATCGCTTGCG
ATGCCCCATCCCACCTCAAAGGTTCTCAGGTCACTAGCAT
GCCCAAATTGAATTGCAAGGCCCCATCTGTATCCATTACA
TATCAGCCAAACATAGAAAAGTCTGAACTCTATGAGGGAT
ATATGGTTATGCTATACTGCGAAACAAAAGGAACACCCAA
ACCCGAGGTCACATGGGAGATATTTGCTGGAAACCAACTG
ATTACATTCCCTTTGCCTGCTATTGTTGAAAAAACTGACA
TTCCGATTAATGGCCCACCTACAAACACCAGGTTCCTCGT
GTTTCAAAATGGCACCCTGATCGTTCCTCGCATGAGCAAG
AAAGAAGAGGGAAACTACACCTGTTCTGCTGTTAATGACA
TGGGAAAAGCTGAGAGCTCAGTTAGACTTGTTGTCGCAGG
CACTAAAAAGCATGCCACCAATTCTATGCTGGACACGAAA
TCACCAGGGCTTTTACCAGAAGACAAACTCGGTTCAAAAG
GCTCCAAAAACAGCGTGATTAGCATGAGGCCTAAATTTGA
AGAGAAGACTAAAAGTCTTCCCACTGGCACATCTGTCATT
ACAGTGGATAAAGAGCAAGTAGATAAAGGGGCTGATACTT
TGCCATTTGTTGGTAAATGTGGAATAAATGACGGCACACA
GTACATTTCTAACCATGCTTTCAACCTCAGCTTGGATGAA
CTTAAACAGTACACATTTGATTTTGGGGTTATCGCTCTGG
AAGTTTCAGAGACTGAGGCTAAAGTTCAGCTGAACCCTAT
GCAGATGGCCAACGCAAAGTCAAACATTCACCTCAGTCAA
CAACAAGACCTCCAAACTGTGAATAAGGAGCCTTTTAGTC
TTTTCCAAACATCCGCCAAAAAGTCACCACTAGACTTGTT
GTACCTTTGTGTCAGTACTGGCAATGGACATTCAGTGGTG
CAGTGGTCCAAGATAGAAGAAGGCGTCAACGCCTATCGCT
TTCAGCACCTCAAGCCAGGCACCAATTACACCCTCTGTCT
CACCTACGGAGGCCAAGACTGCCAAGTCCAAGTGGTCTTC
ACAACCCGAAAGAAAATCCCATCCTTGTTAATCATTGTAG
TCGTTAGCATCTTTCTACTAGCTTTGGCAACCGTGCCCCT
TCTGGGTGCCACCTGCTGTCATTTGCTCTACAAGTATCAA
GGCAAGACCTACAAGCTGATTATGAAAACACAAAACCCAG
ATCAGATGGAAAAGAACATAGCGACAGATTTTGATCCCAG
GGCGTCATTTGTGGGATCCGAAAAGAATTTTAACCCCAGT
GAGATGGGAGAGGGAGAAGGCGAGGCTGATGGCGAGGAGG
GAGACGGAGAAGGAGAGGACATCGAGGGCAGTGTGGTGAC
CGAGTCCATTCCAGAGTCACAGTCCAAAACACAAGAGGAG
TTTGAAGTCGGTTCCGAGTACAGCGATCGGTTACCCCTTG
GAGCTGAAGCAGTAAACATATCAGCGGAGATCAACGGTAA
TTACAAACAACCACGCTGAGATGTTTACTCTGAAACACGT
AAAAATGATTCGTCATCTTACAAAATACACACTCTTAAAC
ATAAAGGTAACAAAACGGTTTTCTTTTTTTTTCATAGTGA
TGCCATAGAAGAAACTTTTTAGTCCATTCCAAAAAACATT
TTTTATAGTCTGAAGAACATTTAAAAAATCTGACCAACCT
TTTAAAGCTTTCAATTTTCCATAGATGTTAAAGTTCTTAA
TGGAACCATCGATGTCGAAAAACAGCCTTTATTTTTAAGA
GTGTGACCCGCGCTGACAAACGCGCGCTCGTTTTTACCTC
AGCAAGTTAGCCAAGTGCAAAATGATGAGTGTTCAGTAAT
ACAAAAAGATTTATCTAGTGTAATGGACATAAAATGGGTG
AATCTATCTTTATAAAACCTCACAATACAATTCACCTTAC
GTAAGTTTCGTCACTTTGGCACAATCCATACACGTAGCAT
CCATTTTAAGTCATCGAGGTGCAAAAAAAGTACTGTATAG
TGGACATCAAGCGCTTCTGAGGGGAAATAAATACCTGTAC
TCTTTTCACAGCATGTGATATAAATGTCTGGAAAACGAAC
CAGGTCACCTTGAAAACATACGTTTGTTATGTGTATAATA
TGGGTTTCTCCCCCAAAATATGTGATTTTTAATCTCCGCG
AACGGGTGCTTTGACGATATCTCTAGCCTTTACGGATTAC
AACGTGTCCTTTCTTCTCTCTGAGATAGCCTACTTGTTCG
TGGCATGTCACACAAAAGTATTTTCAAGTGTGTTTTATTA
GGGTACTATAGATTGTAGATATTCAGTGTCGATTTGTGAT
GTAAGCCAAGTCATCCGAGATGTTCTCTCTTTTTTATGAA
TATAAATGGTCCGTTTTTACCATCGAGTGTCCAGTAAATT
GACGCATATAGTGGCTTGTTTCGTGTCCAGCTGTCCAATG
ATGTTGTAAAAAATGCTCAGACCTTTTAAAGATTTTTGAT
ATGATTTTATGTACGTGACCTTAATAAAATATTAAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations