header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-19025
Transcript Name: cpa1-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038675 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038675|OTTDARG00000028414|ZDB-GENE-050522-438 cpa1|no_translation cpa1-002 LG_none CT033837.10,CT573397.14 Danio rerio protein_coding KNOWN, 319 bp
GCTCTACTGAAGGCAGCAGAATGAAGGGTTTACTGGTTCT
CACTGCGCTTTTTGTGGCCGTGTTCGGCAAAGTGACTTTT
GAGGGCTGGACTTCTGGATGACTCCTGCTAGAGAGTCTCT
GCCTGTTGATCTTCATGTCCCCTTCCACAGTCTCCAGGCT
GTCAGAGCGTTTCTGGCCTACAATCAGATCCCATATCACA
TCATGATCGAGAATGTCCAGGATCTGGTGGATGAAGAACA
ACTGCAGATGTTGAAATACCGCGGCTTTCCGAGAAGCACC
GATGACTTTGTCTACACCACCTACCATGATTTGGACTCC

cpa1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cpa1-002 319
mRNA cpa1-201 (1) 1479
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cpa1-002 Contained in:
OTHER cpa1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038675 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN765878 (1) 844bp
    CITATIONS (1)