Transcript

cpa1-201

ID
ZDB-TSCRIPT-090929-19024
Name
cpa1-201
Previous Names
  • cpa1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038674 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038674|OTTDARG00000028414|ZDB-GENE-050522-438 cpa1|OTTDARP00000030980 cpa1-001 LG_none CT033837.10,CT573397.14 Danio rerio protein_coding KNOWN, 1479 bp
ATAAACGGTCTGTTGATGGGGAAAGCTCTACTGAAGGCAG
CAGAATGAAGGGTTTACTGGTTCTCACTGCGCTTTTTGTG
GCCGTGTTCGGCAAAGTGACTTTTGAGGGAGATCAGGTTC
TTAGGATCAATGCAAAAAATGCAGAGCAGATCTCACTTCT
AAAGGAACTGACTGAAGCTGACTTACTAGGGCTGGACTTC
TGGATGACTCCTGCTAGAGAGTCTCTGCCTGTTGATCTTC
ATGTCCCCTTCCACAGTCTCCAGGCTGTCAGAGCGTTTCT
GGCCTACAATCAGATCCCATATCACATCATGATCGAGAAT
GTCCAGGATCTGGTGGATGAAGAACAACTGCAGATGTTGA
AATACCGCGGCTTTCCGAGAAGCACCGATGACTTTGTCTA
CACCACCTACCATGATTTGGACTCCATCAACTCTTTCATG
GATATGCTGGTTGCAGAAAACCAGAACATGGTCAGCAAAA
TTGAGATTGGTCAGAGCTATGAGAACCGCCCCTTGAACGT
CCTGAAATTCAGCACTGGAGCAAACCGTCCTGGTATCTGG
ATAGACACTGGTCTCCACTCCAGAGAATGGATCACCCATG
CTAGCGGAATCTGGTTTGCCAAAAAGATCGTGACTGACTA
TGGACGTGACCCAGTCCTCACCGACATCTTGAACAGCTAT
GATATCTTCTTGGAGATCGTCGCCAACCCTGACGGTCTTG
CCTACACCCATAGTGATGACCGCATGTGGAGGAAAACCAG
AAAGCCCAATCCTGGCTCCAGCTGTGTCGGAGTTGATCCC
AACCGAAACTGGGAGACTGGCTTTGGTGGCCCTGGATCCA
GCAGCAACCCATGCTCTCAGACCTACCATGGTCCCAGCAT
TCATTCTGAGCCTGAGGTGAAAGCCATTGTAGAATTTGTG
AAATCTCATGGTAATCTCAAGGCCTTCTTGTCCATCCACA
GCTACTCCCAGATGCTTCTCTACCCATATGGATACACACA
AACCGCTGCAAAGGACCAGGCTGAACTGCATGAGCTTGCC
AGAAAGGCCACCAGTGAACTGCAGTCTTTATATAACACTG
CCTACACATATGGCAGCATCATTACTACCATCTATCAAGC
TGATGGAGTCACTACTGACTGGGCCTATGAACAGGGCATC
AAGTACTCCTACACCTTTGAGCTGAGAGACACCGGTCGGT
ATGGTTTCATTCTGCCAGCCGATCAGATCCTGCCCACCGC
CGAGGAGACCTGGCTCGCTCTGATGGTCATCATGGAGCAC
ATCAAGAATAATCCTTATTAAGCATACAGCATTTTTGTGA
TTAGTCAAAGTGCAGGAGTAAGCCAAAATGTACCATCAGC
CGGTCATTAATGCAAAAATGGGTTTACTTTTTGTATTAAT
GGTTGTCAGATTGTAGGTTTTACAGCTTATTACATTACTT
GATGACAAATTAATAAATATGTGATATGAAATATTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations