header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18967
Transcript Name: med19a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038599 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038599|OTTDARG00000028379|ZDB-GENE-060929-232 med19a|no_translation DKEY-6I22.3-002 LG_ CU062437.8 Danio rerio protein_coding KNOWN, 920 bp
GGTATACACAACTCCGGTAACCGGGAGTTGTGTGCGGCTT
TTTATTAGTATTTTTATAATAATATGTAAATGGTTTAGAT
TCAAATATCATGACGGAAATATTTTCTACTTTATTCGGAC
AAAATGACGCACAGCCGCCCTCTGGACCAGCAGCTTTAGG
GTTTGCTCCCGGAAAACCTCCCCCTTCTATGCCGCCAAAC
CAGGCGCCAATAGCGGCCCAGATGCCAGGACAACTCGGGG
ATGATGGGCCTCTTCTGCGAAAACCCGGAGCTATGAACGA
ACCTTTTTATCTACTTCGAGAACTCCCTGTTGGAAACGAC
CTGACGGGAAACACGAACCTGATCACGCATTATAATCTGG
AGCACGCCTATAATAAGTTCTGCGGGAAGAAAGTCAAGGA
GAAACTGAGCAACTTTTTACCAGAGTTACCAGGTATGATA
GACTGTCCAGGGGTCCAGGATGGCAGTTCTCTGCGCTCTC
TCATAGAGAAACCTCCCGTCTGTGGAAACTCATTCAGTCC
GCTGACAGGAGCTCTACTCACTGGATTTAGACTACACACT
GGCCCGGTGAATCAATGCATTAACACGGGCCCTGTTCACA
CCTGACATAAGGAATGCATTATTATCAAAGTCTATAGAAT
ACACAAGATGTGTCACTCATATAGTTTTGAATTGGAAAAT
GTGTTGACGGTCAATATGGCGAATGAAGCCTCGCCTTCTA
GTACAGGAGCCAATCAGCAATCATTATAGATAGAGGTGTT
TCTGGGGGAGGGGCTCACACCAGATTTTTTCTGGTTCAAA
CGTTTAGAAATGAATCTAAACAGACAGTTGTTGTTCAATT
TTATTGATGTTTCCTAATAGAGCCTTTTCACAAGACTGTT
ATGACACATTTAACGGTCATCATAGTCTTAAATCCTTAAA

med19a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA med19a-201 (1)    Ensembl 1066
ncRNA med19a-002 920
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
med19a-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000038599 (1),  Ensembl_Trans:ENSDART00000144754 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH581211 (1) 936 bp
GenBank:EH598578 (1) 828 bp
CITATIONS (2)