header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18966
Transcript Name: med19a-201
Previous Name: med19a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038598 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038598|OTTDARG00000028379|ZDB-GENE-060929-232 med19a|OTTDARP00000030927 DKEY-6I22.3-001 LG_ CU062437.8 Danio rerio protein_coding KNOWN, 1066 bp
AATCATTACGGTAACGCTACTGTTGATAATGTGATGAACC
GGACAGCTGCTCGCTGGTATACACAACTCCGGTAACCGGG
AGTTGTGTGCGGCTTTTTATTAGTATTTTTATAATAATAT
GTAAATGGTTTAGATTCAAATATCATGACGGAAATATTTT
CTACTTTATTCGGACAAAATGACGCACAGCCGCCCTCTGG
ACCAGCAGCTTTAGGGTTTGCTCCCGGAAAACCTCCCCCT
TCTATGCCGCCAAACCAGGCGCCAATAGCGGCCCAGATGC
CAGGACAACTCGGGGATGATGGGCCTCTTCTGCGAAAACC
CGGAGCTATGAACGAACCTTTTTATCTACTTCGAGAACTC
CCTGTTGGAAACGACCTGACGGGAAACACGAACCTGATCA
CGCATTATAATCTGGAGCACGCCTATAATAAGTTCTGCGG
GAAGAAAGTCAAGGAGAAACTGAGCAACTTTTTACCAGAG
TTACCAGGTATGATAGACTGTCCAGGGGTCCAGGATGGCA
GTTCTCTGCGCTCTCTCATAGAGAAACCTCCCGTCTGTGG
AAACTCATTCAGTCCGCTGACAGGAGCTCTACTCACTGGA
TTTAGACTACACACTGGCCCGCTTCCTGAGCAGTACAGAC
TGATGCACATACAGCCACCAAAGAAGAAGAGCAAACACAA
ACACAGACATCATCACCCTCAGGATCCTCTACCGCTAGAA
ACCCGCACTGACCCCACCAAGAAGAAGAAAAAGAAAGATA
ATGAACCTGAACGCAGGAAGAAAAAGAAAGACAAGAAGAA
AAAAAAGAATCGACACAGTCCTGATCATCCTGGTGTTACT
GGATCTCAACCCAACAGCAACAGCCTGAGATAGAACAGTT
GTGTGTGTGCGAGTGTGTTTGTTTGTATGTATGTTTGCAC
ACATGAAGTGATGTTGAACTGTGTTAGAGACTCTGATATG
GACCAGTGCGGTTGATTGATGTTTACAAGGGCCAATTGTT
GATGATTTTTGACTTCTTTTTCTGGTTATGATGAAAAGCT
CAAGGAATAAACTTTGTTATTCTTTA

med19a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA med19a-201 1066
ncRNA med19a-002 (1)    Ensembl 920
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
med19a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000038598 (1),  Ensembl_Trans:ENSDART00000054410 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC124344 (1) 1031 bp
GenBank:EH587195 (1) 894 bp
GenBank:EH598782 (1) 654 bp
CITATIONS (2)