ZFIN ID: ZDB-TSCRIPT-090929-18965
Transcript Name: ndufs8b-202
Previous Names: ndufs8b-001, ottdart00000038597, zgc:109991-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: pseudogenic transcript
Annotation Status: variant
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038597 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038597|OTTDARG00000028378|ZDB-GENE-050522-131 ndufs8b|OTTDARP00000044334 DKEY-83D4.3-001 LG_ CT955967.12 Danio rerio polymorphic_pseudogene none, 1002 bp
ACACTCCAATGACTAACAGGCCGAAGCTTCAGGTTGATGA
GGATGGAGATGACATTGCGCATACTGTTTTCCTCCTGCCG
CACAGGCACTTTTGCAGCCAGACTTGGGCCTGTTCGCCCC
TTCAGCCTTACCATTCACAGAGGAGGCTACAAGTATGTAA
ATGCAGAAGATTTGCCTTCTGACCTGAAGTCCATCACAGA
CCGTGCAGCACAGACACTGCTGTTGACCGAACTGTGCAGA
GGTTTGGCCATGGCTGTGAGTTACTTGTTCAGAGAACCAG
CTACGATCAACTACCCCTTTGAGAAAGGCCCTCTCTCTCT
CCACGTTTTCGCGGTGAGCATGCGCTACGCAGATACCCAA
ACGGAGAGGAGCGCTGTATCGCATGCAAACTGTGTGAAGC
TGTCTGTCCTGCTCAGGCCATCACTATAGAAGCAGAGACT
CGTGCAGACGGCAGCAGAAGAACAACCCGTTACGACATTG
ACATGACCAAATGCATCTACTGTGGATTCTGTCAGGAGGC
CTGTCCTGTAGATGCAATCGTAGAGGGCCCTAATTTTGAG
TACTCCACTGAGACGCATGAAGAGCTGCTGTATAATAAAG
AGAAACTGTTGAATAATGGAGATCGATGGGAGGTTGAAAT
TGCTGCTAACATCCAGGCGGATTACCTGTACAGATGAACA
ATTGCACAAACCTCCTGATGATAGTCAGATAACAGGAAAA
CAAGGAGCTTCATAAGCTGCATTTAGTGGATCTGAACACT
GCACTGTATAGAACCATAGAAACGCACACATCAATCAGTT
GTTAAGTATGAAATGAAATGCACAAATCAAACCAAATAAT
GTTTATTTTGATTTAATTGTTCATTCAGTGTATTCAAACT
TAGCTTTTCTCAGGGGCAAATAAAATACACCTCTGCATGT
AAATGTTTATTGGGAATTGACATTGCTTATTTTTTTTCTT
TGATAAACTTTACTCATGTAAATAAAAAAGAAGCACAATA
AG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ndufs8b-202 Contained in:
[BAC] DKEY-83D4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038597 (1),  Ensembl_Trans:ENSDART00000165795 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)