Transcript

slbp2-002

ID
ZDB-TSCRIPT-090929-18948
Name
slbp2-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038577 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038577|OTTDARG00000028363|ZDB-GENE-070112-1722 slbp2|no_translation DKEY-8F23.2-002 LG_none CU462984.5,CT027639.10 Danio rerio protein_coding KNOWN, 776 bp
GTGTGGCTGTACGTTAGCCAAAATCATGACAACACGCATA
GAAAGCCTTCTTCAAAGCCCCTTTGAGTCGCGGTTGTATG
TTTCAAAGCTTGTTTTGTGCCTTTAAAGTGTCCTCATGTG
TTGTTGTCCTCATGTAGTATCGTAAAACACTTTGTATTTT
GTTATTTTTTGTGATTTAGAGGTCTGCCTCTTCACTTGTG
GCCAACAGACGTTGCTCAAGACTTCAGTAGTAAAACCCTC
TCTCTCCCATGTAGCCCAGAGCCTTGGCTGCTTCCTGGCT
GCAGTTCAGTGTATGATAGTCTTGTCAGCTGCTCTAAAAC
CCCATTGTCTGCTTCACAAAATGGAGAAAAGCCTTCTGCT
GTTCAGAAGCCTCGCAGATCCTCCATCCTTGAGCGATGCA
TACTTAGGATGTCTACAGCTAGTGTAGCTGTTGGGACGGA
AGATCTTGATGGGGTCAAGAGGTCACCATCAAGGGGAAAG
TGGTATCCCCATAATGCTGACCCTTCTCATTTTGAGATCA
ATGAGGCTGTTTTGAAGCGTAGGCAAAAGCAGATTCAGTA
TGGGAAGAATACCTGTGGCTACCAGAACTACGTTCAGCAG
GTTCCGAAGCGTCTGCGTGTCCCTGGAATTCATCCTTCCA
CTCCAAACAAATACCGCAAATATAGCCGCAGATCTTGGGA
CATGCAAGTCCGGCTTTGGAGGAGAGCACTTCATGCTTGG
GACCTGCCATCTGCATCGCAAAATGATACTGAAGGACAAG
ACCCTGTTGATCAACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations