ZFIN ID: ZDB-TSCRIPT-090929-18844
Transcript Name: grhpra-201
Previous Names: grhpr-001, grhpra-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038461 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038461|OTTDARG00000028283|ZDB-GENE-040724-230 grhpra|OTTDARP00000030822 grhpra-001 LG_ CT573279.9 Danio rerio protein_coding KNOWN, 1413 bp
GCTGAACGGGACTCTTTACAGCCCACTGTCATGCACTTTT
TTTAGTGCTTCCCAGTTCCCACATTGTAAATAGGGAAGTC
TATCTGTGTTTCTGCGAAGTATTATCTACATTTATTCAAT
TAACGTTAATCAGTCGTTTTACTTTAATCGTGCAGGATGA
GCGCGCACCAGATGCTGAAAGTGTTCGTCACGAGACGCAT
TCCGCAGGAGGGCATGAAAATACTCCAAAAAGCCAGCATG
TGTGATTTGTCACTGTGGGACTCTGATGAGCCTGTGCCCC
GGGCTGAGCTCCTGAAGGGGGTGGCAGGTGCTCATGGACT
CATCTGTTTACTTTCTGACAAAATTGATACCGAGGTTTTG
GATGCAGCGGGGCCCAACCTGAAAGTGATCAGCACTCTCT
CCGTGGGATTTGACCACCTCGCTATTGATGAGATCAAGAA
ACGAGGAATACGAGTTGGCTACACTCCTGATGTTTTGACG
GACGCCACTGCTGAGCTGACGGTGGCTCTCCTTTTGGCCA
CTGCCCGACGGCTTCCTGAAGGTGTAGAGGAAGTAAAAAA
TGGTGGCTGGAGCACATGGAAGCCTCTGTGGCTGTGCGGT
TATGGTCTTTCGGGCAGCACTGTTGGGGTGATTGGACTGG
GACGCATAGGTTTGGCCATTGCAAGGAGACTGAAACCTTT
TGGAGTGAAGAAACTTTTGTACACGGGCAGAAAACCCAAA
CCTGAAGCTGAAGAGGTTGATGGAGAATATGTGCCTTTAG
ACACTCTGGTGAGAGAGAGCGATTTTGTGGTCGTTTCCTG
TTCTTTGACTCCTGACACTCAAGGCCTTTGTGACAAAACC
TTCTTTGGGAAGATGAAGAAAACATCAGTGTTTATCAACA
GTAGCAGGGGAGCCGTTGTGAATCAAGAGGACTTGTTTGA
AGCCCTCAGCAGTGGTCAGATTGCAGCAGCGGGGCTTGAT
GTCACAAGCCCTGAACCGCTGCCAACTAACCATCCATTGC
TGACGCTTAAAAACTGTGTGGTTCTTCCTCACATCGGCAG
TGCCACTTACTCTACCCGCGGTGTTATGAGTGAACTGACG
GCAAACAACTTACTGGCAGGCCTGACGGGCTCTGAAATGC
CCAGCGAGCTGAAAATGTAGCAATCTAACTCGTGCCTTAC
ACTGACAGAAAACCAGTCTAACCTAACAACTGAATGCACT
ACATTTACCATGAGATTAGATGGGATAAAACATGTATTAG
ATTAGGTTTATTGGATAACCTCATTCCAACACAATGATTT
AATACACTCATTTGCTCTAACTGTGAAATTCGAGATTCAT
TCAACACTCAACTGTCCTTATACACTCCATGATGCTGATT
AAAGATGCTGAAGAATGAATGATACAGAACAATAAAGGAT
TTACTGAAAAGTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grhpra-201 Contained in:
[BAC] DKEY-109L4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038461 (1),  Ensembl_Trans:ENSDART00000098640 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095040 (1) 1380 nt
GenBank:CN016143 (1) 943 nt
GenBank:EH598423 (1) 823 nt
GenBank:DV584549 (1) 789 nt
GenBank:DR725178 (1) 779 nt
CITATIONS (2)