ZFIN ID: ZDB-TSCRIPT-090929-18714
Transcript Name: pus1-202
Previous Name: pus1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038324 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038324|OTTDARG00000028202|ZDB-GENE-041212-26 pus1|OTTDARP00000030709 pus1-001 LG_ CR450803.12 Danio rerio protein_coding KNOWN, 1539 bp
CGATATTTTGCGAGATGTGAAAGTTCAGCGGCTCCACGTG
GGAGTATGCATGTTACAGGGGAAGTAAATAAGTTGTAGCG
GTTAAAACGGATGATTCAGCTGTCAAAATACAAAGCATAC
AAAATCAGTGTTATAGATTAATTCCGCTATTAGAAATTCA
CATCAGAGAGAAGCTCCCCGAGAGTCTGCAATGACATGCT
GAAGAGCTCCTGTCGGATCATTAATAGTGTATTATCACAA
CATTTACTCCAGTTTTCAAAATTAAAGGGTGACCAAACTC
GTGTGTTTTGCTCGTCTTTCAACATGACTGAGGATTCAGT
CAAAGCTGTGAAAAGAGCAGCAGATGATGATCCACACACC
GAAACCGAGCATGAAGACAAGAAGCTGAAAACAGACCAGG
AGGAGAGGAAATACCCCAAGAAAAAAGTGGCCCTGCTCAT
GGCTTATTCGGGGAAAGGGTATTATGGGATGCAGAGAAAT
GCAAGAAACTCACAGTTCAAAACGATTGAGGATGAACTGG
TTACAGCTCTTGTTGGAGCCAGATGTATCCCTGAAGGCCA
TGCAGAAGAGATGAAGAAGATGTCTTTCCAGAGGAGTGCA
CGAACTGATAAGGGTGTTTCTGCTGTTGGTCAAGTTGTTT
CCCTGAAGGTGTGGATGATTGAGAACATCCTGGAGAAAAT
CAATGCTCATCTGCCACCGCAAATCAGAGTTTTAGGTTGC
AAAAGAGTCACCGGTGGCTTCAATTCCAAAAACAACTGCT
ACGCCCGCACCTATTCCTACATGCTGCCCACTGTGGCCTT
CTCCCCGAAAGACTATAACCAGGAGGACACGTCTTTCCGT
CTGACCTCAGACACCCTTCAGACGGTCAACCGGCTATTCG
GCCTGTACAAAGGCACCCACAACTTTCACAATTTCACCTC
GCAGAAGGGCCACCGGGACCCCAGTGCCATGCGCTACATC
ACCCACATGTCCTGCGGGGAGCCATTCATCAGGAAAGACG
TTGAATTTGCCGTCATCACAGTCCGAGGCCAGAGCTTTAT
GATGCACCAGATCCGCAAGATGATCGGCCTCGTGATCGCT
GTGGTTAAAGGATACGTGGATGAAGGGGTGATAGAGAAGA
GCTGGGGAGAGGAGAAAGTTGGTGTTCCCAAAGCTCCGGG
GCTCGGGCTGGTGCTGGAGCGGGTGCATTTCGATGGCTAC
AACAAACGTTTCGGAGGAGATGGCATTCACGAGACTCTTG
AATGGACCGAGCAGGAAGAAGCCATCGCGGATTTTAAGGA
AAAGCACATATATCCTACTATCGTGGACACCGAGCTCAAT
GAGAAGTCAATGGTAAATTGGATGACGTCGCTGTGTATTC
ATGATTTCGAAGAGACGGCCACAGGAAATCAAGACCGCAA
AGATGATGACGAAGATGGAAATGCATCTGACTGAACCAAA
GGAAACGGATCTCCTTTTTTTGTTTGTTTTACTTTTGTGA
GAATTCAATTCCTAAGTTTGCATTATTATAATTCTGAAAT
AAAAAAAGCTTTTATTAAG

pus1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pus1-201 (1)    Ensembl 881
pus1-202 1539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pus1-202 Contained in:
[BAC] DKEY-11O18 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038324 (1),  Ensembl_Trans:ENSDART00000144859 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC050502 (1) 2932 nt
GenBank:BC086827 (1) 1460 nt
GenBank:EB768724 (1) 560 nt
CITATIONS (2)