Transcript

mipa-201

ID
ZDB-TSCRIPT-090929-18643
Name
mipa-201
Previous Names
  • mip1-001
  • mipa-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038253 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038253|OTTDARG00000028170|ZDB-GENE-040801-41 mipa|OTTDARP00000030655 mip1-001 LG_ CR354433.25 Danio rerio protein_coding KNOWN, 2844 bp
ATCAGAGAGGCTGAATGTCTGCAGGACATGCTCATCACTT
GTCAATCCGTGTTCCTTTATTAAACCTCAGCTAGAACTTC
CTCATAGATGCAGAGACCACCAGCCAGTTTCAAACTCAAG
GTTTTATGACAAAAGCCAACAGGATCGATGATTTCAGTCT
TGTGAAGCAGGACTGCCTTTCATGCCAACTTCTTTGTAGC
TTGTAGAAGCATTTATGCTTATTTTTCCATAGTTCACACA
CCTTTGTTTTTTTTTTGTGTGTGTGTGTGTGTCTCCATCC
GCAAAAAAACCAAAGGGATCACATCCAGATCTGCTCATCT
TTTTTTGGTGGCTTTCATCCCTCCATTTTCTTCCCTCTGC
ATTGCTTCTGTTGACTTTTTGCAGCCATGTGGGAGTTCCG
GTCCATGTCTTTTTGGCGGGCTGTGTTTGCCGAGTTTTAC
GGCACCATGTTCTTTGTGTTCTTTGGTCTGGGAGCTGCTC
TCCGCTGGACCACCGGGCCACACAATGTGCTTCAAGTGGC
CTTCTGCTTTGGGCTGGCAGCTGCCACGTTCATCCAATCC
ATCGGCCACATCAGTGGTGGCCACATCAACCCGGCGGTTA
CTTTCGCATACCTGATTGGCTCCCAGATGTCCCTGTTTCG
TGCCTTCTTCTACATCTGTGCTCAGTGCTTGGGTGCATTG
GCTGGCGCCGCTGTGCTTTATGGGGTCACGCCAACCAACA
TGAGAGGAAATCTTGCCTTGAATACGCTTCAGCCTGGCAT
CAGTATGGGAATGGCCACTACCATAGAAATATTCCTGACC
CTGCAGCTTGTGGTTTGTGTGTTCGCTGTGACCGATGAGA
GGAGAAACGGGCGACTGGGGTCTGCTGCCCTGTCCATTGG
CTTTTCTGTGCTAGTGGGACACCTGCTGGGGATGTATTAC
ACTGGAGCCGGAATGAACCCCGCCAGGTCTTTTGCCCCTG
CTGTGCTCTATAGGAACTTCATTAACCACTGGGTGTATTG
GGTGGGCCCTATGATCGGCGCTGCCATGGGAGCTCTGCTC
TACGACTTCATGCTGTTCCCACGCGTGCGGGGTCTGTCCG
AGAGACTGGCTGTGCTCAAGGGAAACAAACCAACAGAGCC
TGAAGCCCAGCAGGAGACGCGAGGAGAGCCAATCGAGCTC
AAAACACAAGCCTTATAAACACTGCCAGGAAACTGTGGAT
CCCTAAAGCGACGCATACGTATGATCATTTTACACACACA
CACACTTCCAGAGGCAAATCAAGACACCGTAACCCCTTCA
CAAGGACTATGAATGAGGGTAAGAAGTACCCGCTCAGGGG
CACCTCTGTCATTTCTAGTCTACTATGAGTGAACTACACT
AGAAGTGGACTTCTGCATGCTTTCCGGTTTCACAGGCTTT
CAATGATCTCACATTCATTTCACTTTCTTTTTTCTTTTCT
TTGATTTATCCAGAGACGTGACACGTGTACTACATTATTA
GCATTTTGCAACAGATTTCTACTTACTGTCGACATTATTC
AGTTGTGCATGGTGTGTGTGCGTGGGTGTTTTCCGACAGT
TTCCAAGTTTGGCTCTTCCATTTTCCACAATTCGCTATTT
GTTTGTATCAATGCAATGTTCTTTTTTTTTCTATCTCCCA
AAATGAAGGAAACATTCCTTTGATCTTTGGTTTAGGTGGA
TGTTCATTCACAACTGAAAGCTCTATAAATCCTTTGGGAA
CTTTGATCCCTCTTCCGAGTCCGTTTCAAACTGTTGTATC
GTTTAACGGCAGCCCACAGTGGCCCAAGTATGAAATTCTT
TATAAGAAACGCAGTCACACCATCATTCATTTATCTAAAA
AATAAACAAATAAACACACAAAACACAACTAGTCTATTGT
TATAGCCCAAATTTCACCTTTATACAGACAGAGCGGGAGG
TATTTGTTTACAATAATACCGTAAGTGTTGTTTTAACTAT
GCGTGAGCTGTCACTGACACACTCAGCTCACTTTACGGAA
AATACAAACACACGTCTTGTGAGTCCAAAAGCTTTGAGCG
CATGTTGAAACCTGTTAGTTACAGACACAACTTAAGAAAG
CAGAAGATATCTCTGAATGGGTTGTTGTTTTCTTACATGT
ATAATATATGATACTGTAAAGCACACAATATCACATAAGC
AAGAGTGCCATTTTCCATACAAAATAGATTTTTATATTGG
GTTAGCTACTGTACATTTTAGAGACCATATAGTGTTTTTT
TCCGTTTCACGCAAGAAGCCAGAGATTTGTGCATCTCAGA
GTAAAACCGCTGTGTTTTGTTCCTGAATGAATCTTATTTT
TGAACAAATGGAATGAGGAAATGATTCAATAATCCATTTG
CATGACTTGTTTCCTTTCTAAATGAATCTGCAGTTTTGAA
TGAATCAATTAAATAAACGATTCAGTGAACTTTTTGTCAA
CTTCACACTCCCCAAACAAGAAGTTTTTACCCTCAGTAGA
GTTTAGTACTTTTAAAAATATTCCAAAGTACATTGTTGTT
TTCTCAGACTTATTTTTTTCGTCTGCATTTTCTGTGTAGA
TTAGCAGGTTTGGCATCATTTTGTGTGTAAATAGCTTAAG
TTGTGTTCTGACATTTAGTCTCAGGCAAATGAACATTTCT
GTAAATCACTGTAAAAGAAATATGAAGCCTTACTGATGTG
AGCAGAACAGGTTTAAAACATCATGGACTTATTAGTGACT
GTTTCTGTTTTTTACAGTAGACTGGTACAGGGATTATGTC
AAGACCTGAAAGAATTCTTCACTGTGGATTTTCCCATGGA
ATATTTCAATTTACGAGTAAAATAAAGACTGTGCTAATGT
AAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations