Transcript

hsc70-201

ID
ZDB-TSCRIPT-090929-18634
Name
hsc70-201
Previous Names
  • hsc70-001
  • zgc:63663-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000038243 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038243|OTTDARG00000028164|ZDB-GENE-040426-1221 hsc70|OTTDARP00000030648 DKEY-238D18.2-001 LG_ CR944667.15 Danio rerio protein_coding KNOWN, 2469 bp
GCTTCTGCCTCTGAGTCCGGCAGCGCAGGAGTGCAACAGG
CACCAGGACGAGCTGAGGGGGCGAAAAGACATTCATTACA
ATCCGTTATCTCTCAGGAAGAACTTTTACATTAAGACAGG
ATGTCAAAAGGTCCAGCAGTGGGTATTGATCTGGGCACCA
CCTACTCATGTGTGGGAATCTTCCAGCATGGAAAGGTGGA
GATCATCGCCAATGACCAGGGAAACAGAACGACCCCCAGC
TACGTCGCTTTCACGGACACCGAAAGACTGATCGGAGATG
CAGCCAAGAACCAAGTTGCCATGAACCCTTCTAACACTGT
GTTTGATGCCAAGCGCCTGATTGGACGACGCTTTGATGAC
CCAGTGGTTCAATCTGACATGAAGCACTGGCCCTTTAAGG
TAATCAGTGACGGCAGCAAGCCCAAAATGGAAGTGGAGTA
CAAAGGAGAGATAAAGACTTTCTTCCCTGAAGAGGTGTCC
TCCATGGTCCTCACTAAGATGAAGGAGATCTCCGAAGCTT
ACCTTGGCAAGACTGTATCAAATGCAGTGATTACGGTGCC
TGCTTACTTTAATGACTCCCAGCGCCAAGCCACCAAAGAT
GCTGGAACCATCGCTGGCCTTAATGTCCTTCGCATCATCA
ACGAACCAACAGCAGCTGCTATTGCATATGGATTGGACAA
AAAGGTCGGTGGTGAGCGCAATGTCCTCATCTTTGATTTG
GGTGGTGGCACCTTTGACGTGTCCATTCTGACCATCGAGG
ATGGCATTTTTGAGGTCAAGTCAACAGCAGGTGACACCCA
TTTGGGTGGTGAGGACTTCGACAACCGCATGGTCAACCAC
TTCATCACCGAGTTCAAGCGCAAGTTCAAGAAAGACATCA
CTGGCAATAAACGTGCTGTCCGTCGCCTGCGGACAGCATG
TGAGCGTGCCAAGCGCACCCTTTCATCCAGCACACAGGCC
AGCATTGAGATCGACTCTCTGTATGAAGGTGCTGACTTCT
ACACTTCCATCACCAGAGCCCGTTTTGAGGAGCTCAATGC
TGACCTGTTTCGCGGTACACTGGAGCCAGTGGAAAAGGCT
CTGCGGGATGCCAAGATGGATAAGGCACAGATCCATGACA
TTGTGCTGGTTGGTGGCTCCACTCGTATTCCCAAGATCCA
AAAGCTGCTTCAGGACTTCTTTAATGGGCGAGATCTTAAC
AAGAGCATCAACCCTGATGAAGCCGTAGCTTATGGAGCTG
CTGTCCAGGCAGCCATCTTAACAGGTGATACATCAGAGAA
TGTGCAAGACTTGTTGCTGCTGGACGTCACTCCTCTCTCT
CTGGGCATTGAGACAGCAGGTGGTGTCATGACCGTGCTAA
TTAAGAGGAACACCACCATTCCCACTAAGCAAACCCAAAC
CTTTACCACCTACTCAGACAACCAGCCGGGTGTACTCATC
CAGGTATATGAGGGAGAGAGAGCCATGACAAAGGACAACA
ACATTCTTGGCAAATTTGAGTTGACCGGCATCCCTCCTGC
TCCTCGTGGTGTGCCACAGATTGAAGTTACCTTTGACATT
GACGCCAATGGCATTCTCAACGTATCCGCAGTAGACAAAA
GCACTGGCAAAGAGAACAAGATCACTATTACCAATGACAA
AGGTCGTTTGAGCAAGGAAGACATAGAGCGTATGGTACAA
GAGGCTGACCAATACAGAGCAGAGGATGAAGTACAGAGGG
AAAAGGTCACCGCCAAGAACACTCTGGAGTCCTTGGCCTT
TAACATGAAGAGCACTGTTGAGGACGACAAGTTGCAGGAC
AAGATCAGTCCAGAGGACAAGAAAACTATTACTGACAAAT
GCAATGAGGTCATCTCATGGCTGGACAAGAACCAGACCGC
AGAAAAAGATGAGTACGAGCATCAACAGAAGGAGCTGGAA
AAAGTGTGCAACCCCATCATCACTAAGCTCTATCAAGGCG
CTGGTGGCATGCCAGGTGGGATGCCAGGTGGGATGCCCGG
CGGTTACCCTGGAGGGCAAGGAAGTGGTTCTTCCTCTGGT
CCTACCATTGAGGAAGTGGACTAACTTTTGGCACCAGAAC
ATCCAGGCTTACACAAAGAAAGAAACCAAACACTCTGCAG
CATGTCAAACAGGCTTCTTTTCAAATAGCATTTACTCACA
TTGGTCAGATATGTGCCAGATGAGACCAACTTATAGCTTG
TGACCAAAGCAATAAGGCACCTTCAAAACTGCATTAGCAT
TTTAGTATCAAATCTGTAATCTACCTGGCTGTAAGCTATT
ATATCAGAGCTATTATACGCTTAATAATGCGATAATTAGA
AATAAATACCAAGCTGAGGTGAGGCCTTGTTATTTGTCCA
GTTAGCCGTTATGCTCATTATTCAGTATTTCACAATTATA
AGCTTAAGAATAAATTCAATAATTGTTTCCGGTGTGACCC
AACAAAAATAAAGCATATTATTTTCTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations