ZFIN ID: ZDB-TSCRIPT-090929-18584
Transcript Name: birc5b-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038193 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038193|OTTDARG00000028140|ZDB-GENE-030826-2 birc5b|no_translation birc5b-002 LG_ CU041401.4 Danio rerio protein_coding KNOWN, 612 bp
GTTATCGCCTCCAGACTGCTGTCCTTTAATCAGATGTATA
GTTATGAAAAAAGACTTCAGACTTTTTCCGAGTGGCCTTT
TCGAGAAGATTGCCAGTGCACACCAGAACTGATGGCGAAG
GCAGGATTTGTTCACTGTCCCAGTGAGAATGAGCCAGACG
TTGCCTGCTGTTTCTACTGTCTTCGCGAACTGGAGGGCTG
GGAACCAGATGACAATCCCTGGTGAGCTCTAGCAGTGGCA
GCACACCTCATCAGCCATTCGCACGGTTCTTCTCTGCACA
CCTTTTATTTACTTAAATGCTGTTTCTCACTGCGATTGTA
GTAGTTCACTTTAGGTCTGAGCATGCCAAACGCTCCCCCA
ACTGTGCCTTTCTTCACATGAGTAAGACATTTGATGAGCT
CACGGCCATCGAGTATTTTCATCTGGAACAGGAGCGACTT
CGCATCTACATTAAAAAGATGGGTCATCGGAAGATTGCCT
ACTTTCGTGATGAGGTGGAAGCCACTAGCAAAAATTTGAG
AGCTCTTATTTGATCTTCAATTAATTACAATTTAAGCTAA
ATAATTTTATTTGTACACTGACTTGCATCAATAAATTAAA
TGTTTGTTTAAT

birc5b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA birc5b-201 (1)    Ensembl 598
ncRNA birc5b-002 612
birc5b-003 (1)    Ensembl 525
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
birc5b-002 Contained in:
[BAC] DKEY-104L7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038193 (1),  Ensembl_Trans:ENSDART00000139111 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH560691 (1) 719 bp
GenBank:EH539509 (1) 651 bp
CITATIONS (2)