Transcript

guca1b-201

ID
ZDB-TSCRIPT-090929-18559
Name
guca1b-201
Previous Names
  • guca1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038168 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038168|OTTDARG00000028129|ZDB-GENE-011128-6 guca1b|OTTDARP00000030595 guca1b-001 LG_ CR388168.14 Danio rerio protein_coding KNOWN, 1302 bp
GTCCTTGTGCTGAATCTCAATCCAGTAGAGCACCTTCACC
GGCAGGTTGAGTTTACTTTTACACTTTGGTAAACACAGAC
ACCTTTTAACAACTTTATTTTTCTTCAAAGTGTCTTTTTT
TATTGTATTGTATCATCAATTTGAGTAGCTTAGGGGTTTA
TTGGGATGTCTGGATCAGGAGGAACTCCAGGACACTAAAG
CAGCCATATGTGATCATGGACATTTTGTGTTGAGAAGTAG
AGCTTGTGTGTTTTTTGTTTTCATCTTTCGTGATGGGTCA
GCGGCTCAGCGATGATTCGGACGAAAAAGAGATTGATGTT
GCTGAACTACAGGAGTGGTATAAGAAGTTTGTGATTGAAT
GTCCGAGTGGAACCCTCTTCATGCACGAGTTCAAGAGCTT
TTTCGGTGTTACTGAAAACCCGGAAGCAGCGGATTACATA
GAAAACATGTTCCGGGCTTTTGATAAAAATGGGGACAATA
CTATTGATTTTCTGGAATACGTGGCGGCCTTGAATCTAGT
GCTGCGAGGGAAGTTGGAGCACAAACTGAAATGGACATTT
AAAATGTATGACAAGGATGGAAGCGGTTGCATCGACAAAA
CAGAGCTCAAGGAGATTGTGGAGTCAATCTACAGACTAAA
AAAAGCCTGCCATGGTGAACTCGATGCAGAATGTAACCTG
CTTACCCCAGATCAGGTGGTGGACAGGATATTTGAGCTGG
TGGATGAGAACGGAGATGGAGAGCTTTCTCTGGATGAGTT
CATTGACGGGGCTCGGCGTGACAAGTGGGTCATGAAGATG
CTGCAAATGGACGTGAACCCCGGGGACTGGATCAATGAAC
AGAGACGCCGCAGCGCCAACTTCTGAACTCCACATTCACC
AAAATAACCCTTAACATAAGCCTGCCCTTTAACCAGTCTC
AGTCCTGGGTTGTCAAAGTCAATCTTGAGTCATCAGTATA
AACTGTATATACTTCTATCAACTACTTTATACATTATCTC
CTAGTCCTTTTCTGACCAACAGAATTTAATCACTTTTACA
TGTGTATATTCATTTTTTCTTCATTGTTTCTTGTTTTATT
GACTTTTTGTTATTAGGACTATTATTATTCAGCATATAAG
TGCATCTGACCTTTACTGTATATGGCATATTACTCAATTC
ATACAAAACAGCCAGTTTCAAATGGGCATATCTTTGTAAA
TATATGAATATTGTAAAGAGCTAAGTTTTTTGAAGGTCCT
AATTGTAAAGGCACAGAATCTGTAAATGTCTCAAAAATAA
AACTCACCAATTGTATATTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations