Transcript

naca-203

ID
ZDB-TSCRIPT-090929-18543
Name
naca-203
Previous Names
  • naca-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038152 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038152|OTTDARG00000028121|ZDB-GENE-020423-4 naca|OTTDARP00000030582 naca-002 LG_ CR381647.10 Danio rerio protein_coding KNOWN, 825 bp
CTCCTGCGTAAAATCTATTGTCATCCAACGTTGCTTTAGC
CAATTCAATACATAATTTGTAGCTTATGCTGATGCTTTAG
TGTAGCTGTGTTTGGAATGTCCAGAATGCCAGGCGAAGCC
ACAGAAACTGTCCCTGTTACAGAGCAGGAGATGCAGCAGC
CCCAGGCTGAGACGGGGTCTGGAACCGAATCTGACAGTGA
TGAATCTGTTCCTGACCTGGAGGAGGGAGACTCTGCACAG
ACACAAACACAGCAGGCACAGCTTGCAGCTGCAGCCGAAA
TCGATGAGGAACCTGTTAGCAAAGCAAAACAAAGCAGAAG
TGAGAAAAAAGCTCGCAAGGCTATGTCCAAACTGGGGTTG
AGACAAGTTGCCGGTGTTACCAGGGTAACCATTCGCAAAT
CCAAGAACATTCTCTTTGTCATCACCAAACCAGATGTCTA
CAAAAGTCCGGCTTCAGATACATACATCGTCTTCGGCGAG
GCCAAGATTGAAGACCTTTCCCAGCAAGCTCAGTTAGCAG
CTGCAGAGAAGTTCAAGGTTCAAGGAGAAGCAGTTTCAAA
CATCCAAGAAAACACACAGACGCCCACAGTACAGGAGGAG
AGCGAAGAGGAAGAGGTTGATGAGACCGGAGTGGAGGTCA
AGGACATTGAGCTGGTCATGTCACAGGCCAATGTATCCAG
GGCGAAGGCTGTGCGCGCACTGAAAAATAACAACAACGAC
ATTGTCAATGCTATTATGGAATTGACGATGTAGATGGACA
TCAGGGACTGGGTCACATTAAGATGATGCTGATTTGATCT
ACACTATTGTTTGTACAATTTATAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations