Transcript

naca-201

ID
ZDB-TSCRIPT-090929-18542
Name
naca-201
Previous Names
  • naca-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000038151 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038151|OTTDARG00000028121|ZDB-GENE-020423-4 naca|OTTDARP00000030581 naca-001 LG_ CR381647.10 Danio rerio protein_coding KNOWN, 915 bp
GACAGAATTACCTGAAAATGTGGTTTCTTGTTATAGACTT
CAGCTTATCCGACAGTGACTTCCTGTTGGGACCGGAAGCA
GAGCAGTGACATCAGAGTGACGCAGAGGTCAGAAACCCTC
TCTCACAGCCATCTTGGATCCTGTGCCCTGAACTATCCAG
AATGCCAGGCGAAGCCACAGAAACTGTCCCTGTTACAGAG
CAGGAGATGCAGCAGCCCCAGGCTGAGACGGGGTCTGGAA
CCGAATCTGACAGTGATGAATCTGTTCCTGACCTGGAGGA
GGGAGACTCTGCACAGACACAAACACAGCAGGCACAGCTT
GCAGCTGCAGCCGAAATCGATGAGGAACCTGTTAGCAAAG
CAAAACAAAGCAGAAGTGAGAAAAAAGCTCGCAAGGCTAT
GTCCAAACTGGGGTTGAGACAAGTTGCCGGTGTTACCAGG
GTAACCATTCGCAAATCCAAGAACATTCTCTTTGTCATCA
CCAAACCAGATGTCTACAAAAGTCCGGCTTCAGATACATA
CATCGTCTTCGGCGAGGCCAAGATTGAAGACCTTTCCCAG
CAAGCTCAGTTAGCAGCTGCAGAGAAGTTCAAGGTTCAAG
GAGAAGCAGTTTCAAACATCCAAGAAAACACACAGACGCC
CACAGTACAGGAGGAGAGCGAAGAGGAAGAGGTTGATGAG
ACCGGAGTGGAGGTCAAGGACATTGAGCTGGTCATGTCAC
AGGCCAATGTATCCAGGGCGAAGGCTGTGCGCGCACTGAA
AAATAACAACAACGACATTGTCAATGCTATTATGGAATTG
ACGATGTAGATGGACATCAGGGACTGGGTCACATTAAGAT
GATGCTGATTTGATCTACACTATTGTTTGTACAATTTATA
CCCAAGAGAAATAAAGGAGTGGCTTGATAATGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations