ZFIN ID: ZDB-TSCRIPT-090929-18522
Transcript Name: ppp4r2a-201
Previous Name: ppp4r2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038131 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038131|OTTDARG00000028113|ZDB-GENE-030131-4922 ppp4r2a|OTTDARP00000030565 ppp4r2a-001 LG_ CT027567.10 Danio rerio protein_coding KNOWN, 2977 bp
GGTCAGGCAGGTAGTGACGTCACCGGCGCCATATTAAAGA
TTTGCTGCTGTTTTCTCCGTGTCGCTGTTGCCATCTTTCT
GTTTCCAACTGGACTCAGAGAGACTAGAGAGTAGTAAACA
TACCTCCACAATGGAAATCGACACGCTTCTGGGAGCATTT
CGAGATTTCGAGAAGAAAGGAGAAAAGGAAAGCTGCCCAA
TTTTGGATCAGTTTCTATCGCATGTTGCAAAAACAGGAGA
GACCATGATTCAGTGGTCTCAGTTTAAAAGCTACTTCCTC
TTCAAACTTGAAAAAGTGATGGATGATTTTAAAGCCTCAT
GTCCAGAGCAACGGGGACCTGCAAATCCAAATGTTGAGTA
CATTCCCTTTGAAGAGATGAAGCAGAGGATTCTCAAAATC
GTCAATGGGTACAACGGGATTCCTTTCACTATTCAACGGC
TATGTGAGCTGCTTACTGAGCCAAAAAGAAACTACGCAGG
AACAGACAAGTTCCTCAGGGGTGTGGAGAAGAATGTAATG
GTGGTCAGTTGTGTGTATCCTACCTCAGAGAAAAAAGGGT
CAAGTTGTGTGAACCGAATGAATGGTGTCATGTTTCCTGG
CAACACTTCAGCTTTTCCAGATAGAAATGTGAATGGTCCG
GGAACACCAAGGCCACTGAATAGACCAAAACACTCCTTAT
CCAGCAATGTAGCTACAAACGGCCTTCCTGACAGCACAGA
AAGCAAAGAACAAGCATCTGAGCAATCAGAGAGGACGGTC
AACGAGTCTTCGGCATCAGAAGCACAAGGTCACAGTGGTG
CAGTGAAGAGTAAACATCGTGACGACGAAGATGCTACACA
TGCAGAGACACATGAAGCAAAGAGGCTTAAGTTTGACAAG
GAGGAAGAGGAGGAGGAGGATGATGAGGAAGAAGATGAAG
ATGGGGATGAAATAAAGAAAGAGCTTGATGAACCGCACTC
ACCCTGCACATCAGTAGCTGAGAGCTCATCAGACGTACCG
CAGTCTTCAACAGACGTCACTGCTGAGGTGAAGGATGAAG
ACCAAGAGCCCTCTAGTACACAGTCAGAGGTCGTAGAAAA
TGGGGTTGACAGATCTACTTCAGAAGATTCACCCGACCCT
TCCCACAACAAGGCAACCGGCAGTGAATCGGACCCTAAAG
AGCAGCAAGCGGAGGAGGAGGAGGAGGAAGAGGAGAGCGC
AGAGGCTCAGGAAACAGAGGAGACAAATGACCCAGTCAGC
AGTAGCAGCAATAACAGCAGTGACGAGGGAGTGTCCAGTG
CAGAGACTCCATCCGCATCTCCCAGCAGTTCCACAGAGCT
GCCAGCAGAGGGCAGTGTCACCGCAGAAATCACTTCAGAC
AGCTCAGAGACTGCAGACGACAACATGGAGCAAGACTGAA
GTGTGGCCACACGCTGTTGATTTTTACACTCTACTGTACA
AACCCCCCCACAAATCACTTATCCTGCAAATTTAGCAGAT
CCTTTATAGACCAGGAGAAGAGGGCATTTTGGTGACGCCC
CTAAAGAGCTCTCGAGACACATCTCCTCCTTTTGAGCCTC
CTTTGGGCTTTCTGTTAATATGGGTTCTTCTCTGAAGAAC
CACTTGAAAAACTGGAAGCTCACTTTTCTGATGGCTTAGC
AGAGCGTTTGCCATTGAATAACACAAGTCCTTGTGTCCAT
GGCGGTTTTCTGTAATCCTACTCTAATCATGGGTGTCCAT
CAAAATCATGTCTCTCGCCTGCTTTTCTAGGCGTGAAAAC
GTGGCACATCTTTGGTTTGTGTGAACATACGTTTGAAGGG
TAAGGGGCGTATGTGCACTTCCTTTTAGTTTTGTCCAGTC
AACAAATGATCTCAGGATTCCCGTTGAATGGCAGACCGGT
GTCTAAACATTCCAGGAGAACACCCACTTTTGCCCTTATT
GCCTTCTGCATTCATCTGGTGGATTGTAGCACAAAGTGCT
CAATAGCAAAATTTAGACCGATTTCCTTTCTTTGCTAATT
GTTTCTCTTTTATTTTTAGCTCCTTTGATTTTAACTGCCT
TCCCAGCATAGCACCGAAATGTATTAATCCACTGATGCTG
GTAAATAGATTCTAAAATGGACTAATGTGATTTTCCATGC
ACTAGATACTTGAGTGCTGTTGGTTGCAATGTGTAACTTA
ATATAGTGAGCCTGTTTTTTCAACCGACATAATGTGCTTA
ACCACTATTGAGCCATTCTTATTTGTTATGAGCTTTTTCA
TTTTCTTTCATAAAACGACGGCAAACAGTTGTATACAATT
GAAATGAACAACACTGTCAACAGCAACATCTCTTAAACTG
TACTTTTCATGCTTCCTACAGACATGTGTAGAGGCTGTCC
CACCCATACCTATTTCCACAGCTCCTTTTTGATATGTAGA
ATTTTTAAATTAGATTTTTGTAGATTATTATAAGTGTTCA
CTGCTTTTGTGAAAAAGTGAAATTGTATGATCTCCATGTG
AACTGAATGCTTGGGCTTTCAACAGTATTTCTGAAGAGCA
ATAAATGTTCACATTAAAAGCGGTGATATGATTAATCTGT
GGCAACTGGAGACAGTTCTAATCATTCGTCTCATTTAAGG
TCATGGACACAGTTCGTTTGCATCACAAAATTTGCTAGTG
AAGCCTAAAACTGATGGACATCACATATAATGCTGTTCAC
AACAGACGCGGAATGCATGAATAAATTGTGCAATTCATGT
GTAAATGGACGTGAACATTTTGAGTTTACTCACTTCATTC
ACGTGTCAAGTGGGCAGGAGCTGGTATAAGTTTCTGATAA
CCTTGGATAAAAATATCACGATTACACGGCATCCCAGTAT
TGTCTAAAATATATTCTTTTTAAATGTCTGGGTAAAAAAT
AACACATTTTCCCCCCTTTGAAAACAATATATTCTATCTT
TTGAAAGATTTAAAACATTTGAGCAGTAAACATGTCAGGC
TAAATAATGAAAATGAA

ppp4r2a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ppp4r2a-002 (1) 320
mRNA ppp4r2a-201 2977
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppp4r2a-201 Contained in:
OTHER ppp4r2a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038131 (1)
  • Ensembl_Trans:ENSDART00000035693 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC060912 (1) 2954bp
    GenBank:BC151885 (1) 2516bp
    GenBank:CK709278 (1) 558bp
    GenBank:CK680104 (1) 324bp
    CITATIONS (2)