ZFIN ID: ZDB-TSCRIPT-090929-18523
Transcript Name: ppp4r2a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038132 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038132|OTTDARG00000028113|ZDB-GENE-030131-4922 ppp4r2a|no_translation ppp4r2a-002 LG_ CT027567.10 Danio rerio protein_coding KNOWN, 320 bp
GGTCAGTTGTGTGTATCCTACCTCAGAGTGAGTGAACCTT
TCTTTGTTGTATTTTCCGGTTTATTGAGTGGGATTTCAAT
ATCAGCTTTCGTCCAACCATTCTGATTTCCTTAATTCTAC
CATTCATCATTTTTTACAGGAAAAAAGGGTCAAGTTGTGT
GAACCGAATGAATGGTGTCATGTTTCCTGGCAACACTTCA
GCTTTTCCAGATAGAAATGTGAATGGTCCGGGAACACCAA
GGCCACTGAATAGACCAAAACACTCCTTATCCAGCAATGT
AGCTACAAACGGCCTTCCTGACAGCACAGAAAGCAAAGAA

ppp4r2a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ppp4r2a-002 320
mRNA ppp4r2a-201 (1) 2977
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ppp4r2a-002 Contained in:
OTHER ppp4r2a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000038132 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT621764 (1) 320bp
    CITATIONS (1)