ZFIN ID: ZDB-TSCRIPT-090929-18446
Transcript Name: gfer-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038052 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038052|OTTDARG00000028072|ZDB-GENE-060810-186 gfer|no_translation gfer-002 LG_ BX649547.7 Danio rerio protein_coding KNOWN, 840 bp
ATAACAACATGGCAGCTGCACACGGGTCGTCTCCACATAG
CAGCGCGGGTATGGAGGGTTTCCCGTTCCCCGTGGCTGGC
AAACCACCCGAGGACAGTACGAGTAATGACCAGACCACTA
CCGGAGAGACGAAAAAGAAACCTTGCCGAGCTTGTACGGA
TTTTAAGTCATGGATGAAGTTACAGAAACAGGCGTCCTCA
GCCTCGGTGCAGGAGAGCAGGCCGGTGGAGGAGCTGAAGC
CTGTTGAATGTCCGCTGGACCGCGAGGAGCTGGGTAGGAG
CTCGTGGTCTTTTCTTCACACTATGGCTGCGTATTATCCA
GATGCACCGAGCACAGAACAGCAGCTCGAGATGACGCAGT
TCATCAACCTTTTCTCTAAGGTTTTCCCATGTGATGAATG
CGCAGAAGACCTGAGAACAAGGTCTTCATCTTTAATTGCT
GTGGTTTTCATGTTTGTCCATTGCTGTTTTCAGCAGCACA
TGATTCAGTCAGTTTGTTTACATGGACAACAATTCTGATA
TTAAATGTAGCTCTCTGATTAACGATCTCTACCATGTAAA
CAGATTTTTATTAACATTAATACAGAAAGTTATACTCAAA
GTAAACACAAGTGTAATTCACTCATCTGGAGTAGTGCTAT
TTTACTCATATTATCAAAGTGTGGTATATAGACATGTACG
CATATATCACTTTATTACTGTCATGTAGGATTTTTGGTTA
CAGCACAGTGATACAGCAGTAATCAAAAGTTTGACGACAT
GGCTGAGAGGGCAGAATTTGTTTCTACTAAGGTCTGTTTA
CATCAGGCGTGTCCAAACTCGGTCCTGGAGGGCCGGTGTC

gfer TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gfer-201 (1)    Ensembl 918
ncRNA gfer-002 840
gfer-003 (1)    Ensembl 825
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gfer-002 Contained in:
[BAC] DKEY-19E10 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038052 (1),  Ensembl_Trans:ENSDART00000131904 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV484178 (1) 843 nt
GenBank:CV482627 (1) 774 nt
GenBank:CK698089 (1) 769 nt
GenBank:CT701809 (1) 673 nt
GenBank:EH543251 (1) 661 nt
GenBank:EH536030 (1) 654 nt
GenBank:EH553776 (1) 642 nt
GenBank:EH546276 (1) 640 nt
GenBank:EH542190 (1) 597 nt
GenBank:EH545428 (1) 585 nt
CITATIONS (2)