ZFIN ID: ZDB-TSCRIPT-090929-18445
Transcript Name: gfer-201
Previous Name: gfer-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038051 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038051|OTTDARG00000028072|ZDB-GENE-060810-186 gfer|OTTDARP00000030497 gfer-001 LG_ BX649547.7 Danio rerio protein_coding KNOWN, 918 bp
CTCCTACATAACAACATGGCAGCTGCACACGGGTCGTCTC
CACATAGCAGCGCGGGTATGGAGGGTTTCCCGTTCCCCGT
GGCTGGCAAACCACCCGAGGACAGTACGAGTAATGACCAG
ACCACTACCGGAGAGACGAAAAAGAAACCTTGCCGAGCTT
GTACGGATTTTAAGTCATGGATGAAGTTACAGAAACAGGC
GTCCTCAGCCTCGGTGCAGGAGAGCAGGCCGGTGGAGGAG
CTGAAGCCTGTTGAATGTCCGCTGGACCGCGAGGAGCTGG
GTAGGAGCTCGTGGTCTTTTCTTCACACTATGGCTGCGTA
TTATCCAGATGCACCGAGCACAGAACAGCAGCTCGAGATG
ACGCAGTTCATCAACCTTTTCTCTAAGGTTTTCCCATGTG
ATGAATGCGCAGAAGACCTGAGAACAAGATTGAAAACTAA
TAGACCAGATGCAGGCAGCCGGCACAAGCTGTCACAGTGG
CTGTGTCGCCTCCATAATGACATCAACATCCGGTTGGGCA
AGCCGGAGTTCGACTGCAGCAGGGTGGATGAGCGATGGAG
AGACGGCTGGAAGGACGGATCTTGTGACTGAAACCTCCGA
CACTGTCATGAACACGAGTGAAATGCTTTCACATGCTGAT
TCTGTGGACCTGGTATTTCTGATGCAGTGAGTGCAGGCTG
AATTGCCAATCAGGAATCAGACATATGTTGACATCGCACT
TTATACTTGTTCTAATTGATGTAATGATTTAGCAGTATAG
AAATGTCTATGTTGTGCTTTTAATCAAGAGTACGGTATGG
TGTGAACACCTTGTTTTTGGATTGTGGAGCTCTCAAGTGG
AAGTAAATAGCCCAGACTGTATAAACTTTGATATCTGTCC
CACAGAAGGAAATAAAGATGGTCTATTTATTTAAAGCA

gfer TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gfer-201 918
ncRNA gfer-002 (1)    Ensembl 840
gfer-003 (1)    Ensembl 825
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gfer-201 Contained in:
[BAC] DKEY-19E10 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038051 (1),  Ensembl_Trans:ENSDART00000102526 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC139530 (1) 1020 nt
CITATIONS (2)