ZFIN ID: ZDB-TSCRIPT-090929-18426
Transcript Name: zgc:162936-202
Previous Name: zgc:162936-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000038029 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000038029|OTTDARG00000028058|ZDB-GENE-030131-5253 zgc:162936|OTTDARP00000030478 DKEY-77F5.2-001 LG_ BX000999.10 Danio rerio protein_coding KNOWN, 1386 bp
AACTCTGCGCCGTGCTCTTGGGTATGTTGTGATTCTGCAG
GAGAAAGTGTCTAAAAACACAAACTCCTGAAGCGACTGAG
GTATAAAGATGGCGTTTATTAAAGTGGAGAGTGAAGATAT
GATGATTGAAGAAACATTCACAGTCAAACATGAAGAGACT
GAAGAAGCTTTCAGAGTCAAACATGAAGATCCTGAGGAAC
AAACAGACCTGGTGGGACTCAAAGAAGAGGAAGAAGAATT
GAATGACATGGAGGGGAAAGAGCAATGTGTGAAACATCAA
GACTTTGTGAATGTAGAACAGTTTATTAAGATCGAACCGA
CTTCATCAGGAAAAACAGATCAGAAAAACAAACCTAATCA
GCTGTTCATCTGCCAACAGTGTGGAAGAGCTTTCAGTCGG
AAGTATAAACTGAAGAATCACATGACGATCCACACTGGAG
AGAAGCCTTTCACCTGTGAGCAGTGTGGGAAGAGCTTCAA
TTACAAGGAAAACCTTAATTACCACATGAGAGTTCACACC
GGAGAGAGGCCGTTCTCCTGTAAGGAGTGTGGAAAGAGTT
TCGTTCACAAAGCAGCTCTTAAATACCACACCAGAGTTCA
CACCGGAGAGAAGCCCTTCACCTGTGAACTGTGTGGAAAG
AGCTACGTTCACAAGGGAAACCTTAATTACCATAAGAGAG
GTCATACTGGAGAGAGGCCGTTCACCTGCGAGCAGTGTGG
AAAGAGTTTCGTTCAGAAACACAAGCTTAATAACCACATC
TTAAGCCACACTGGAGAGAAACCCTTCAAATGCCTGCAGT
GTGGAACCGGTTTCAGTTGCAAAGCAAACCTTCACACCCA
CATGAAAGTCCATTCTGGAGAGAAGCCGTTCACGTGCCAG
CAGTGTGGGAAGAGTTACACCAAAAAAAGCAACCTTAAAA
AGCACATGAACGTCCACACTGGGGAGAACCTGTTCAGATG
CGAGCGGTGCGGGCAGAGCTTCAGATATAAACATTCATTG
GATTCTCATATACAAAAGAGAGAGCTCAGCGGAGGGAACT
GTCTTATTAAATACACTGCAGAAAAGCCTTACGCGTGCCA
GCTGTGTGATAAGAGCTATAAAAACAAAACACACTTTGAT
TCCCACATGAAAATACACGCTGGAGAGAAACCGTTCCCCT
GTGATCAGTGTGGAGGGAGCTTCAGCAATAAAGCAGCCCT
TGGCTCACACATGAAGGTTCACATTGGTGAGTCCTCACAC
TCGGTAAATGCACAGAAATCTGTTGATCACTAATGACAAG
TGATTCGATTGTGATTTGAGAAGGGATTCGATTGGTTGAG
GGTTTTTATCCATGCATTGCATGCACACAGTCTATAATTA
AACAATACAGTCAAACAACCATGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:162936-202 Contained in:
[BAC] DKEY-77F5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000038029 (1),  Ensembl_Trans:ENSDART00000106627 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC134154 (1) 1422 nt
GenBank:BC161659 (1) 1391 nt
GenBank:EH998171 (1) 1059 nt
GenBank:DT875287 (1) 861 nt
GenBank:CO797803 (1) 859 nt
GenBank:CV120837 (1) 765 nt
CITATIONS (2)