Transcript

smg1-201

ID
ZDB-TSCRIPT-090929-18400
Name
smg1-201
Previous Names
  • smg1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000038003 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000038003|OTTDARG00000028047|ZDB-GENE-061013-767 smg1|OTTDARP00000030457 DKEY-66I24.5-001 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 12200 bp
CTCAGTTTCAAACACACTCTGTGAATTTCAAATCTGTGCA
TGGACATAAGCTGAACGGCGATATTAGGGTTTGTCTGAGG
ACTCTTCCCGTGCTAGACGGGTCATGCTGTCTTCGCAAAG
GTAATGAGCCGCAAAGCCCTCGGGTCTCGGCTGAGCAGCG
CCCACAAACTGCAGCGAAACTGGAATGACTGGCAGCCCAG
AAGCGACAGTCTGTCAGCCAGCCAGGACGGTGTGAAGTGC
AGTGTCTCTAGAGACCGCGGTTCAGAAGTTCTATTTGAAA
TTCTGCCCTCTGACCGGCCTGGCACCCCACCACTGCACAA
TGACGCCTTCACTGCCACCGATGCACTCGAAGAGGGAGGT
GGATACGACGCTGATGGAGGCCTCTCTGAAAATGCTTATG
GTTGGAAGTCGCTGGGGCAAGAGTTGAGAATTAATGATGT
GACTACTGATATAACCACTTTTCAGCATGGAAACCGTGCT
TTAGCTACAAAGGACATGAGGAAATCACAGGACCGACCGT
TGGCTCACTCTGAGGAGTCTCGTCTGGCCAATCTTCTGCG
GAGAGCATCACGGGAAGATGACCGGGAACGCAGACTGGCC
ACTATGAAACAAATGAAGGAGTTCATTGTGCACTCTGAAA
ATAAAGTGGTCCTAGTGAAACAGTTGGATTCCATTTTGAG
CACCCTGAATGACATTTTGAATGAGAGTAGTAAGCTCCTG
CAGGAGCTCAGACAGGAGGCCGCTTGGTGTCTGGGATTGC
TCTGTGCCGCCCTCAGTTATGAAGCTGAGAGGATCTTCAA
GTGGATGTTCCTCAAGTTCAGTGTGTCTACAAAGGATGAG
GTGAAGCTTCTGTACCTTGTGGCAGTGCACAAAGCACTTG
AAACAGCTGGGGAGAAGAAGGCCTTTTCAGCTGTAATGCA
GCTGGTGATGAGCAACCTTCAGTCTATATTGGAGAACTTG
GACACACCGGAACTATTGTGCCAAAGTGTAAAGTGTATTT
TACTGGTGGCCCGTTGTTATCCACACATCTTCAGCACCAA
CTTCAGAGACACAGTGGATATCTTGGTAGGCTGGCATATA
GATCACACACAGAAGCACTCTCTTACTCAACAAGTATCTG
GCTGGTTGCAGAGTTTGGAGCAATTTTGGGTTGCAGATTT
GGCCTTCTCGACCACATTATTGGGTCAGTTTTTGGAAGAT
ATGGAGGCATATGCTGAGGACCTGAGCCATGTTGTATCTG
GAGAATCAGGAGATGAGGACATTCCCCCTCCCACTGTGTC
CTTGCCTAAATTGGCAGCCCTATTGAGAGTTTTTAGCACT
GTTGTGCACAGCATCGGAGAACGGTTTAACCCAATCCGAG
GCCCTCCAATTACAGAAGCATATGTCACTGATGTTTTGAA
TCGTGTTTTGGCTTGCGTCACCACAGCCAAGCAGGTGTTC
TTCTCTGAGGCGGTGCTGACAGCAGGAAATGAGTGTGTGT
GTGTTCTGCTGGTGAGCATAGACTTGGGCGGCCAGCTGAT
TGATGCTGTAATCTCATACGGCCTAGACCAGCTGAACTGC
TGCCAGAACTGCGGACCCGAATACAGCCTGTCTGTTCTCA
CCCTGCTCACACTGGTTGTTGACCAAATAAACACCAAACT
TCCGGCTTCTTTTGTGGAAAAGTTGTTGGCCCCAAAATCT
CATCTTTTGGAGCTGCGCTTTCACAGAGAGAGAGAGGTGA
TGGCGGCAGCACATGGAGTGTATCATGCTGTGCTAAGCCT
GAAGAACATCCCTATCTTGGAGGCGGCATATAAACTGGTC
TTGGGCGAGATGGGCTGTGCACTGAACAGTTTGCTGAGCC
CTCTGGGTTTGCCTGATGCCTGTCCTCACATCCAACATCC
TGCTTTCAGCCAGCTGAACTTTAGCCCAGAGAGAGCTGAG
TTTGTCCTCATCTTTAACCTCAGTGCTCTCACCACCATTG
GCAACACCAAGAACTCCCTCATCGGGATGTGGGCTCTGTC
TCCTACTGTGTTTGCCCTGCTCAGTCAGAATCTGGTTATT
GTTCATTCTGATTTGGCAGTTCATCATCCTGCTGTCCAGT
ATGCAGTGCTCTACACTCTCTACTCTCACTGCACCAGACA
TGATCACTTCATCTCCAGCAGCCTGAGCTCCTCGTCCCCA
TCCCTTTTCGACGGTGCTGTCATCAGCACAGTTACCACGG
CAACCAAAAGGCATTTCAGCACGCTCCTTAATTTGCTGGG
TATGCTGCTCAGCAAGGATCATCTCAACCCTGAGGCGAGG
CGGCTGTTACTCACCTGGTCATTGGAAGTAGCTCTGATGA
TGAAGAAATCTGAAACTTACGCTCCTCTCTTCTCGCTCCC
ATCCTTCCTCAAATTCTGCAAAGGGTTACTGGCAAATTCC
TTGAATGAGGACACCACCATATGTCTGCAGGCATGTAACA
GTCTACAGGTGCTGTCATCTTCCTTGACTATGGAGCTTCT
CCAGAGGTGTGTGGACGTGTGCCGAGTTCAGCTGGTTCAC
TCAGCAGTCCGAGTCCGGCAGGCCTTTGGGAAATTGCTGA
GATCTGTTCCCATGCACGTCGCACTGAGCGCCCATAGTCA
CTCTGAGATTAAGGAGATTTCTCTGGCCATCCGCCGACAC
ATGAGCAAAGTGCCTAGCAACACATTCCACCCACAGGACT
TCTCTGACCTTATTGGGTTTATTCTGTACGGAACGGTCCA
TCGTGGGGGGAAGGAGCCCTGGTTGGAGCGTCTGTATCAC
AGCTGTCAGCGGCTGGAGAAGAAAGACTCTGCTATGGTGC
CTCGTGCCCTGCTGAAGACTGAGGCAGTGCTGTGGCAGTG
GGCGGTGTGGGAAGCTGCTCAGTTTACTGTTCTCTCAAAG
CTCCGTACACCTCTGGGAAGAGCCCAGGATACCTTCCAGA
CTATAGAGGGTATGATCCGTAGTCTGGCAGCTCACAGTCT
GAACACAGAGCAGGAGCTGAGTCAGTGGAGCGGAGGAGAG
AGTGATGAGGGTCACCACACCAACCAGCTCCGACTGGCTC
TTCTCCTGCAGTTCCTGGAGAACCTGGAGAAACTCATGTA
CAACGCCTATGAAGGCTGTGCCAGTGCTCTCACTGCACCA
CCAAAGGGCATTAGAACCTTTTTCTACACAAACAGACAGA
CATGCCAGGACTGGCTAACCAGAATTCGTTTGGCCCTAAT
GAGGGTTGGCCTTCTCTCCGGTCAGCCAGCGGTCACAGTC
CGTCATGGCTTTGACCTGCTGACTGAGATTAAAAACAGCA
GTACACAGGGTCCAGAAATGGAGGTTCCAGTGACCATGCT
GGTGGAGGCATTGTGCGAGTTGAGATGCCCAGAGGCTATT
CAAGGTCTGGCAGCATGGAGTCTTGCCAACACTGGCAAAA
GCATGGGCTGGCTGAGCTCTGTGGCACTGCAGGCTGAGGG
AAAGTTTGAGAAGGCAGCGTTAGAGTACCAAGAGCAGCTT
TGTGCTGTCACAGGGATGGACTGCTCCATTAAAGTCTTTG
ATCGCTCACTTTTGAAACTCACTGGCACCAACACCTCCAG
TCCAAAACATACCAGCAGCGGAGAGGGAAGAAAAACTGTA
TTGCTGAAATCCAGCGAGTGTTCTCCAGAGGTTCTGAACT
TTCTGGCTAATAAGGCCTGTGAGTGTTATGTGGCCCTGAG
CGATTGGGAGTCTGTGCAAGAATGGCAGGCCAGCATGATG
AATCTCAAAAAGAACAGCAGCAGTTCCAGTGTCAACCTCA
AGACAGACTTCAACTACATCAGAGCTATGAGCAGGTTTGA
GGAGGGAGATTTTACAGAATGCCGTGCCCAGCTAGAGTTG
CTCCCTGGGGATGATTATGGCCTTCTCAACTCTACAACTA
AGGACAAGATTGACCTTAAGAGGCTTCTTCCTGCTGTGTT
GAGTCCAGACCCATCAGAGCTCCAGAAGGCCATTGAGGTG
CAGCTCCTCAGAAGTGCTGTGGGAGCCATCAGTGCGACCA
ATCATGAGCAGGACCAGAAAGTGGCATCATCAGACACCCT
GGTTAAATATCTGAAGCAGACGGGTCGCATCTGTCTGGGC
CCCCTGCGCCTTTCCACTCTCACCCTGTCAGATTCCCTGC
CCACCCTTAGCACTCTACAGCTGCACTGTGCCAACTCTTT
AGAGAACTCTCTTTGCAACCAACATCCTGAGGACTGCCTT
ATTCCGCTCTTCAGTGAAGCTTTGACCACCTGCAAGCAGC
AGGATGTTCAACCATGGCTGCATGCTCTCCGATACACTAC
TTTTCAGCGGGAATTCTTCCAAAAACTTAAAGTTGATTCT
CATCTGATGGAGCTTTGTCTGACTGCTGTAAAATTTGCTC
GTAAACAAGGGAATATTGCTCTGGCCACACGCCTGCTGAG
TCTATGCAGCAAGCCAGCTATGAGCGACACTGAAGGTCAG
GACCTGGTTCAAAGCTTCAGGCAGCTGTCTCTAGAAGGCA
CTGTTGGGGAAAAGTGGGGACCAGAGCTGGAGATCGAGAA
GGCTAAAGTTCTGTTCGCTGCTGGTCAGTCTGTGTCTGCT
ATGGAGATGTTGAGCTCCTGTGCACTGTCATACTGTCACT
CTGGGAAGTGCGAACTTGCGGCCTGTCGCTCGGTGCTCAC
TCTGTGCAAATGGCTTTTGGCTGACTGGAAAGATCTGACT
CCCCAGCTGAAGATGGTGGTGAAGAAGAACTCTGGGTCTA
CCAGCCTCTCAACTCTCTCCAAAAACATCTCTGGCTTGTT
GGAGCTGCCGCTGGAAGATCAGGGAATGCCACACATTACA
ACAGAGACTACAGTTAGCGTTGGTGTCGGGGAGCCAGACT
TTGTCCTTGGGCAACTTTACCAGCTCTCAACTACTCAGGC
TCCTGAAGTGGCCAAATCTTGGGCTGCTCTTGCCAGCTGG
GCCTACAGATGGGGCAGGAAGGTTGTGGACAATGCCAGTC
AAGGAGAAGGGGTTCCTCTGCTCCTCGGAGAGAAGAAAGA
AATAGAGGAGTTGCTCCCAGCAGGCACCAGCGATGAGGAC
AAGGAAACCATTTTTGGCATTTTGGGTCAAGCCATGTGTC
GCCCAGCAGGAATTCAGGATGAGGATATGGCTCTGCAGAA
TGAAGAAGATGATGAGGACGACATGGTAGATGTAATTGGC
CGACAGCTGTTGGGTGCCTGTCCCTGGCTTTCAGATGTAG
AGGACACTGTGACCGATGGACTCATTGGGGTGTGGAGGAG
AGTGGTTGATCGGATCTTCAGCCTCTACCGGGTCTCCTGC
AGGGCTTACTTCACTTTCCTCAAACTCAATGCTGGACAGG
TGCCTATAGATGAAGATGATCCCAAGCTGCTCCTGAACAA
CCAGAACAGCAAGCAGAGCAGCGATGATGTCATTGTCATG
GCAACCCTCCGTCTGCTGCGCTTGTTGGTGAAGCACGCAG
GAGAGTTGAGGGAAGGTCTGGAGCACGGTTTGGCATCCAC
ACCTACTGCTCCCTGGAGAGGTATTATCCCTCAGTTATTC
TCCAGACTTAATCACCCTGAAGCCTACATCCGCCAGAGCA
TCTGCAGTCTGCTGTGTAGAGTGGCCCAAGATTCCCCACA
CCTTATCCTTTATCCTGCCATTGTCGGATCAATCTCTCTT
GGTGGAGAGGCTCAGACGGCAGGTAATAAGCTGCCATCGT
CCCTGCCAACCCTGCTGGGGAACATGCAGGGAGAGGGTCT
TTGTGGAGGTGAGAGCGAGACAGGCAGTGGGCCGACCTCT
CAGGAGAGCAGCCGCGGGGAAGAGATGGTGATGTATTCCA
GCGAGGATCAAGCCATGATGCAGGACTGCTACAGCAAGAT
AGTAGACAAGCTTTCCTCTGCCAACCCTACCATGGTGCTG
CAGGTGCAGATGTTGGTGGGCGAGTTGAGGAGGGTCACAC
TGCTCTGGGACGAGCTCTGGCTGGGGGTCTTACAGCAGCA
GCACATGCACGTCCTGCGCAGGATTCAACAGCTGGAGGAC
GAGGTGAAGAGAGTTCAGAACAACAACACTCTGCGCAAGG
ATGAGAAGGTGGCTATTATGAGAGAGAAGCACTCTGCTCT
GATGAAGCCTGTGGTTTTTGCGCTGGATCATGTGCGCAGC
ATTACGGCTGCTCCAGCAGAGACGCCTCACGAGGAATGGT
TTCAGGAGACATATGGAGATGCCATCCACAATGCCCTAGA
GAGACTGAGGAGCCCTCTAAATCCAGCCAATCCTGCCAGC
AGCTGGGTGCCCTTTAAACAGATCATGCTGAGTTTACAGC
AGAGGGCACAGAAACGAGCCAGTTACCTTCTGCGTCTGGA
TGAGATCAGCCCACGTCTGACTGCTATGGCTAACACCGAG
ATGGCTCTGCCGGGAGAGGTGTCTGCTACAGATGCAGTCA
CCATCCAGAGTGTGGGCAACACCATCACCATTCTGCCAAC
TAAAACCAAACCCAAGAAGCTCTACTTTTTGGGATCGGAT
GGGAGAAACTATCCTTATCTGTTCAAAGGATTGGAGGATC
TGCATTTGGATGAGAGGATCATGCAGTTCTTGTCTATCGT
CAACACCATGTTCACTAAAGTGAATCAGCAGGAGAGCCCG
AGGTTTCAAGCCCGTCATTATTCTGTCACACCTCTGGGTA
CCAGATCTGGCCTCATCCAGTGGGTGGATGGAGCCACTCC
ACTGTTTGGCCTGTACAAACGTTGGCAGCAGCGTGAAGCT
GTGGTCCAAGCCCAGAAGGCACAGGACTCCTTCCAGCAGC
CTCAGAATCTTCCCATGGTCCCACGGCCCAGTGAGCTTTA
CTACAGTAAAATCAGTCCTGCCTTAAAGGCTGTCGGTCTC
AGTTTGGATGTGTCACGTCGTGATTGGCCGTTAAGTGTTA
TGAGAGATGTTCTAAGAGAGCTGATGGAAGCCACGCCCCC
TAACCTCTTGGCAAAGGAGCTCTGGTGTTCCTGCACCACT
CCTAGTGAGTGGTGGAGCGTCACTCAGACTTACGCCAGAT
CCACCGCTGTGATGTCAATGGTGGGATACATTATTGGCTT
GGGGGATCGTCACCTTGACAACGTGCTGATTGACATGACG
ACTGGCGAGGTGGTGCACATTGACTATAACGTCTGTTTTG
AGAAGGGAAAAAGCTTGAGAGTGCCTGAGAAAGTTCCTTT
TCGCATGACCCACAACATCGAGACTGCTCTGGGGGTCACA
GGAGTTGAGGGAATCTTTAGACTGTCCTGTGAACAGGTGG
TCCAGATAATGCGGCGTGGGAGAGAGACCCTCTTGACTCT
TCTAGAGGCCTTTGTCTATGACCCATTGGTGGACTGGACA
GCAGGCGGTGAGGTGGGCTTTGCAGGTGCTGTGTATGGAG
GAGGTGGTCAGCAGGCTGAGAACAAGCAGAGCAAGAGAGA
GATGGAGAGAGACATCACACGTAGCCTTTTCTCCTCCCGT
GTGGCTGAAATTAAGGTGAACTGGTTCAAAAACCGTGATG
AAATGACTGGAGTGTTGCCACAGCTGGAGGAGGCAGTGGA
TGAGTACCTCAACCTGCAGGAGCAGCTCACACAAGTGGAG
AAGGTGCAGGGCAAGCTGTTGGAGGAGTTGGAGTTCCTGG
AGGGAGCAGACACCAGAGCAGACCATCCCATCCACTCCCT
GGAGCACAGATACTCAGAACACACGCAGCTGCAGTCCAGA
CAGAGAACTGTGCAGGATGCCATTCAAGGGAAGTTGTCAG
ATCTGGATCAATGGATCTCTCAGTATCAAGCTGCCTTTGC
CAGTTTAGAAGCCACACAGCTTGCCAGCCTCCTCCAGGAG
ATCAGTAGCCCTATTGATTTGGGTCCGCCCAGTTATGTAC
CAGCAACGTCGTTCTTGCAGAATGCAGGTCAGGCACATCT
GATCAGCCAGTGTGAAGCGCTGGAGGCTGAAGTGAGTGCT
CTGTTACAGCAGAGGCGCTCTCAGCTGCGAGGTTGTCTTG
AGCACCTGCACAGTTATGCCACCGTGGCCCTGCTGTACCC
ACGTGCCGTGCTGCACAGACACAGAGCTCACACATGGAAA
CAGTGGATGGAGGAGCTGGTGTGTGACATGACGGTCGATC
ACTGCCAGACTATTTATCACCAATACGAAATGCAGTTTGC
ACCCCAGCCCCCACCTGCCACGTGTCAGTTCCTCTCCAGC
ATCGAGATGGCGCTGCAGCACCATGCAGCAGAAACCAACA
CTCGTCTGCTGCGGCAGGTGGAGCGTCTGAAGGCAGAGGG
CGCCAGTGTACCCGTGTGTGAGGAGCAGCTGCAGGAGATC
GAGCGCTGCATCAAAGTCTTCCTGCACGAGGACGCTGAGC
TTGGCTCCTTCAGCCTGGCTGGCATCATCGTCTCTGCCCT
CTGTTCTCTCACCAGGCGTAATTTGGTGATGGAGGGAGCT
GCGGCCAGTGCTGGCGAGCAGCTGGTGGAGCTGACGTCTC
GTGATGGAGCCTGGTTCCTAGAGGAGCTCTGCAGCATGAG
TGGAAACATTACATGTCTTGTGCAGCTGTTGCAGCAGTGC
CAGCTTCTGTCACATGACCTGGACATCCCTAGTCCTGCAG
AAACTTCGCAAGTTGTCTACCTGACCAATGGTGTTTACAC
CTGTCTTCAGGAGCTGAACACAAACTTCCGTCAGATCATC
TTCCCAGAGGCTCTGCGCTGCATGCTGAAAGGTGAAAACA
CTTTAGAGACCATGTTAGCAGAGCTGGATGCGCTTATCGA
TCAGTGTGCAGATGGGGTTTCACTGCAGGGGCTTGGAGAG
ATTTTGATGGCACACATTCGGAACGCCTCCATGGGTCTGG
AAGAGGATCCAGATGACCACTATCTGGACGTTACCAGGGT
TTTGCGAGCCCAGTACTCTGAGCTGATTCAGCCCCGCAGC
ATGGAGAGCTCAGTGCAGGAAACGCCAAAGATGAGCGCTG
GTCAGATGTTGCTGGTAGCTTTTGATGGCATGTTTGCCCA
GTTGGAGACAGCTTTTGGACTTCTCATTGACAAGCTGAAC
TCTATGGATGTCCCTGCTGCCTGGAGAAAAGTGGATGTGA
TCCGGGAGTCGAGAGCCACACAGGCTCATTTCTTTGATAA
TGTCCAGACCAGGCAGGTCTTGGAGGAGATTTTCTTCTTG
AAGAGACTCCAGACCATCCGAGACTTCTTCCGTCTATGTG
GTTCATTTGCACAGACACTATCTGGCACATGCCCTACACC
CACTGATGACCCTCCGCCATCTAATGGCCCTGTTCCCATA
GTAAAGCCCTTGTATCGAGGCTCCACGGTGGTGAGCGAGG
ACCAGATGACGCGGCCCATCAAAGCCTTTACAGCAGACTT
TGTAAGGCAGATGCTGATGGGGCTCCCCACCCAGGCTCTG
GGTCTAGCCATCTGCAGCTCTCTCAGTGCCCTGGGCATGG
ATCTTATTGCTCAAGTGGAGGCCAAGGACTTTGGAGCTGA
GGGAAAAGTCTCTCTGGATGACCTGTGCAAGAAAGCTGTA
GAGCAGGGGGTGCAGGCAGGACGCCTGTCCCAGCTGCTAC
TCAACAGGGCCACCGTGCTGGCCAGTTCCTATGACACTGC
CTGGAAAAAACTTGACCTGGTCCGACGTCTGGAGGTCAGC
ATTGAAGCCTGTAAGGTCAGCCTGCAGAGGAATCAGCTTC
ACATCGCCATGTTCCAGTGGCAACATGAGGACATTCTTGG
TGCGAGGACGCAGCCCATGACAGTCAGTCCTCCACCACGT
TCCATTATCCTCAGCAACATGAAAAAGAAGCTCTACAAAC
TCAGTCAGGATGACGCTTCAATAGGAAGTGTCCAGGAGAA
GTTGGCCAGTCTTGAAGGCAGTATAGAGCAGAGGCTGAAA
TGGGCCGGTGGTGCAAATCCTGCACTCGCTCCAGTGCTGC
AGGACTTTGAGGCCACTATAGCAGAACGCCGTGCCTTGGT
GATAAAGGAGAGTCAGCGTGCCAACCAGGTCACTTTCCTC
TGCAGTACCATTCTCAACTTTGAAGGTCTGCGCACCCGCA
CACCCGAAGCTTTGAACATGGATGCTGCCCTTTTTGAGCT
TGTGAAACGATGCCAGGCCACCTGCTCCTACGCTGCCCAG
TTCAATACCTCTGTTTCCTCGCTAGAACTACAGCTGCTGC
ATAGACTGAGTCCTGCCATGGATATGTCCATTGGTGGTCC
TGAGTGGCTGGTGTATGCACAGAATCACCTGACCCAGGAG
ATGTCCAGTCAGAGAGCCATGCAGGAGGAAAGAGAGCAGC
AGCTGGAGAGCGTGACTGAGACCCTGCAGCTGCTGGTGGA
CTCCATTAAAGGCACCCTGTCCAATCACAACCGCCAGCTC
GCTGACGTTAAACACTTACTGCGAGCAATGGCAAAGGATG
AAGAGAATGCCCTTGCAGAAGGAGAGGAAGTGACTTATGA
TGGGAGTGTGCGTCAGTTCCTTTCTGAATACAAGGCATGG
CAGGATAATGTGCAGATAGTGCTGTTCACAGTAGTGCAGG
CTACAGGGCAACCACGCAGTCAAGAGCAGATCGAGCTGCT
GCAGGAGATTCCCGCCACCTTGAAGGAGCTTAAGGTTCAG
AGCCACAGCATCTACAATGGATTGGTGGGCTTTGCCTCTC
CCCTTGTGACAGAGAGAGGAAGTGACTGTATTAGTCCCAC
TTCCACAGTCCAGACCAGCTTTGCCGCTGCAGTGCGCTGC
AGTGGGGTGAAGACACAGCCTGACAGTATGTCTCAGAATG
CACGCAAAGCTCTTCCTCGAAACTTTGGGACCCCGGCGGA
CACTCCTCCCAGCACACTGATGATCAACAGCAAAGGACTG
GCCCCTAGCCCCAAAAGAGCCGTGCGAGATCCCAAAACTG
GGAGAGCTGTGCAAGAGAGAAATTCATATGCTGTTAGTGT
GTGGAAAAGGGTGAAGGCCAAGCTGGAGGGGAGAGATGTG
GATCCTAACAGGAGAATGAGTGTCACTGAGCAGGTGGATT
ATGTCATCAAAGAGGCAACAAACGTGGACAACCTGGCACA
GTTGTACGAGGGATGGACGGCATGGGTGTGAACGGGATCC
TTGTAGATCACTTTGGTCCAGCGAGGGTAGAAATCCACCG
AAATCCACTGGGTCTGGGGCAATGGAGCCACAGAGCACCA
TGCAGGAAAGGGCCACCCCTAGAGACCCTCCCTCGGGCCC
ACACCGGATCCCCGTAGCTCTGCTACACCCGGCGATCCGG
TAAACTCAACGAAATGGGTCTGCATCTGTCTCCCGAGATG
TGTGGGAGCTCACCAAGATGGGGAGGCGGGGTGGGGGGGA
ATAAGGCACATGGCTTGAACTACCCCCCCCCAACGACCCC
CTGTATCAACAACAACAAATAATAAACGTATGTCAACTTT
CAAAACACATAGGGAAACTATGCAGGAGACAGTTTATCCA
CTCTTAGAGCAGAAGTCTGCTGTAATTAGCGAGTTTCTGG
ACTATGTGTGTTTCGGGAGTGGAAGGAAAAGGCGATCCGG
TCTTGGTCTAGCCTTTTTGGATGGCTCTGGGTCAGGCGTG
ACTTGCGGTTTAACTGTCTCCTGCTGGAGCGGGTGATGAG
AAGGAGGAGGGCGGCTGTGTGACCAGAAGACTCAAAGGAC
TCCATTCAAAGCCAGAAGGCCTTTGGCAGACCTTTAGAGT
TCATTCTTAACCACAAAAACAAAAGAGACCTTTCCCCACT
CTAGTATATATAGAAAACACCTTCACTAGTGTACTGCACC
GATTTCACAATTAAAAGGCTAATTGGCTTTGGGAACATTA
ACTGTCATGTGTTTCTGAATGTTTGGCACAATGGATGATG
TGCTTGGAGTTGGTAAGTGCTCAGTCTGAGGTCTCTTTCA
TTTGATCTTTGTGTATGACCCAGGCTCAATGTGATGAGAT
GTGCGGAAACAAAATCAGTTTCTAAATGCTTTTTTTCTTA
GTATGCATCTCTGACCTTGTTTTGTGTATTTGTAGACGAT
TCTTTCTCCCTTTCCTTCTTTACTATGAATTTAGCCTAGA
TTGCTCCTTTTTTTGACTTGCCTGTGGAACTGTATCATCG
TTGATACATGTCCCCGTTGAAGCTTGCGTTTTACTGATCT
TGACCTAGTTTTACATTTTTAGTGGGAGAATTAAGTAACG
GAATAGTGATGTGGTGATGGTTATTGTTGTGTCTTAATGG
TTTTACTCCATTTTGTTGGTTGAATAAAATTATAACTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations