header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18343
Transcript Name: pitpnaa-202
Previous Names: pitpna-002, pitpnaa-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037946 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037946|OTTDARG00000027994|ZDB-GENE-040426-744 pitpnaa|OTTDARP00000030410 pitpna-002 LG_ CR478288.14 Danio rerio protein_coding KNOWN, 1756 bp
AACTTGAGCTGAAACGAGTCACGGCGGGCAGATCTGAAGA
GTCGACGAGGAAACTCTCTTAAAGCCAGTTTGAATGTTGG
ACACGGGGCGGCAAAGGAGATAACATGTTGATAAAGGAGT
TTCGAATCGTCTTGCCCGTTTCTGTTGAAGAGTACCAGGT
GGGTCAGCTGTACTCTGTAGCAGAAGCAAGTAAGAATGAG
ACTGGAGGTGGAGATGGAGTGGAAGTCCTAAAAAACGAGC
CCTACGAGAAAGAGGATGGAGAAAAAGGACAGTACACGCA
TAAGATTTACCGCTTGCAAAGTAAAGTGCCAAGTTTTGTA
CGGTTACTGGCCCCTTCATCTGCCCTGATTATTCATGAGA
AGGCCTGGAATGCTTATCCTTACTGTCGCACAGTTCTTAC
GAATGAGTACATGAAGGACAATTTTCTAATCATGATTGAG
ACGTGGCACAAACCTGACCTTGGTGAACAGGAAAATGTTC
ATAATCTTGACTCTGAACGATGGAAACAGGTTGAGGTGAT
ACATATTGACATTGCTGACAGATCTCAGGTGGACACTAAG
GACTATAAACCAGACGAGGATCCAGCCACTTTTAAATCAC
AGAAGACTGGTAGAGGCCCATTAGGACCTGATTGGAAGAA
AGAGCTTCCTCAGAAGAAGGACTGCCCTCATATGTGTGCC
TATAAATTAGTCACTGTCAATTTCAAGTGGTTTGGCCTGC
AGAAAAAAGTGGAGGGTTTTATCCACAGGCAAGAGAAGCG
TCTGTTCACCAGCTTCCACAGGCAGCTCTTCTGCTGGTTA
GACCGATGGATCGATTTGACCATGGAGGATATCCGCCGCA
TGGAGGAGGAGACACAGAAAGAGCTTGATAAGATGCGAGA
GAAGGATCCAGTGAAAGGGATGTCTGCCGCAGATGAATGA
GGTGCTGCAGTTGGGACTGTGAGTGTGATTTAGTTTTGAT
GTCTGCAGCTGTTTGGCTGTGTCCTAGTATTGGATCGTTT
CTCTACAGTATGATTGGCTGTTCTTTGTCTTCATCCTTCA
CTCCAGTAGTTTCTCTTTATCCACCTCTGTACAAAGAACA
TCTCATCCTGTGATGTTTCTGAGCATTTTTTTTTTTTTTG
GTCTAGTCCATTTTCCTCAGATTTCCTCTATTTTGATTTT
CAAACTCTGTAATTGCATTTCCATAAATGTTTACCCCCCT
TTTTTGTTTAAGTTCAGCAACACCAGCACTCGTGTATTTA
AACACCCCGTCACTGCTTGCATCTCTAGCATGTTAACATG
CTTCTCAAACAGATGCTCCACCCTTAATATATTTGCTTGA
GGCAGCTTCATCTTGCACAAATAAAAAAACTCAAGATGAA
GCTGCCTCATGTCAAATGACCATGAGTTGATCGTATTAGA
GGGCTGCAGCTGACCCATTGTTACTCATAAGCCACTTTTC
TCAGGACTTTTTGTAGATCTTAAAAGACTGAATTTGAATA
ATGTGGTAATACCAGGTTTACAGTAATGAAGTAATGGTAA
GCTTACTTCAGTTCTGCTGGACTTCCAAACAGGGTCTAGA
GAAGTAAACATTGTGTTGTGTTGGAGATGTATTAGCACAA
GGTTCACTTAAGGATTTATTATGAACTGTATTCAGATGTT
TAAGTGTCATTCTGCTGCTCTGTCCTCTCCAAGACTACGT
TTACTGGACATGGATACAACTCGTTTCATAATTGTGCCTC
GACCCAATAATGATATTAAAAAGAGTTTATATTATT

pitpnaa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pitpnaa-202 1756
pitpnaa-203 (1)    Ensembl 1779
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pitpnaa-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037946 (1),  Ensembl_Trans:ENSDART00000057697 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH546596 (1) 1026 bp
GenBank:EH541794 (1) 986 bp
GenBank:EH562943 (1) 900 bp
GenBank:EH567737 (1) 851 bp
CITATIONS (2)