header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-18319
Transcript Name: pitpnaa-203
Previous Names: pitpna-001, pitpnaa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037922 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037922|OTTDARG00000027994|ZDB-GENE-040426-744 pitpnaa|OTTDARP00000030393 pitpna-001 LG_ CR478288.14 Danio rerio protein_coding KNOWN, 1779 bp
ATCTTTCAGGAAATGAATTTAAAGAAATGAGAAATCCAGG
AACTTGAGCTGAAACGAGTCACGGCGGGCAGATCTGAAGA
GTCGACGAGGAAACTCTCTTAAAGCCAGTTTGAATGTTGG
ACACGGGGCGGCAAAGGAGATAACATGTTGATAAAGGAGT
TTCGAATCGTCTTGCCCGTTTCTGTTGAAGAGTACCAGGT
GGGTCAGCTGTACTCTGTAGCAGAAGCAAGTAAGAATGAG
ACTGGAGGTGGAGATGGAGTGGAAGTCCTAAAAAACGAGC
CCTACGAGAAAGAGGATGGAGAAAAAGGACAGTACACGCA
TAAGATTTACCGCTTGCAAAGTAAAGTGCCAAGTTTTGTA
CGGTTACTGGCCCCTTCATCTGCCCTGATTATTCATGAGA
AGGCCTGGAATGCTTATCCTTACTGTCGCACAGTTCTTAC
GAATGAGTACATGAAGGACAATTTTCTAATCATGATTGAG
ACGTGGCACAAACCTGACCTTGGTGAACAGGAAAATGTTC
ATAATCTTGACTCTGAACGATGGAAACAGGTTGAGGTGAT
ACATATTGACATTGCTGACAGATCTCAGGTGGACACTAAG
GACTATAAACCAGACGAGGATCCAGCCACTTTTAAATCAC
AGAAGACTGGTAGAGGCCCATTAGGACCTGATTGGAAGAA
AGAGCTTCCTCAGAAGAAGGACTGCCCTCATATGTGTGCC
TATAAATTAGTCACTGTCAATTTCAAGTGGTTTGGCCTGC
AGAAAAAAGTGGAGGGTTTTATCCACAGGCAAGAGAAGCG
TCTGTTCACCAGCTTCCACAGGCAGCTCTTCTGCTGGTTA
GACCGATGGATCGATTTGACCATGGAGGATATCCGCCGCA
TGGAGGAGGAGACACAGAAAGAGCTTGATAAGATGCGAGA
GAAGGATCCAGTGAAAGGGATGTCTGCCGCAGATGAATGA
GGTGCTGCAGTTGGGACTATGTCTGCAGCTGTTTGGCTGT
GTCCTAGTATTGGATCGTTTCTCTACAGTATGATTGGCTG
TTCTTTGTCTTCATCCTTCACTCCAGTAGTTTCTCTTTAT
CCACCTCTGTACAAAGAACATCTCATCCTGTGATGTTTCT
GAGCATTTTTTTTTTTTTTGGTCTAGTCCATTTTCCTCAG
ATTTCCTCTATTTTGATTTTCAAACTCTGTAATTGCATTT
CCATAAATGTTTACCCCCCTTTTTTGTTTAAGTTCAGCAA
CACCAGCACTCGTGTATTTAAACACCCCGTCACTGCTTGC
ATCTCTAGCATGTTAACATGCTTCTCAAACAGATGCTCCA
CCCTTAATATATTTGCTTGAGGCAGCTTCATCTTGCACAA
ATAAAAAAACTCAAGATGAAGCTGCCTCATGTCAAATGAC
CATGAGTTGATCGTATTAGAGGGCTGCAGCTGACCCATTG
TTACTCATAAGCCACTTTTCTCAGGACTTTTTGTAGATCT
TAAAAGACTGAATTTGAATAATGTGGTAATACCAGGTTTA
CAGTAATGAAGTAATGGTAAGCTTACTTCAGTTCTGCTGG
ACTTCCAAACAGGGTCTAGAGAAGTAAACATTGTGTTGTG
TTGGAGATGTATTAGCACAAGGTTCACTTAAGGATTTATT
ATGAACTGTATTCAGATGTTTAAGTGTCATTCTGCTGCTC
TGTCCTCTCCAAGACTACGTTTACTGGACATGGATACAAC
TCGTTTCATAATTGTGCCTCGACCCAATAATGATATTAAA
AAGAGTTTATATTATTGTT

pitpnaa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pitpnaa-202 (1)    Ensembl 1756
pitpnaa-203 1779
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pitpnaa-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037922 (1),  Ensembl_Trans:ENSDART00000132028 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC044192 (1) 1752 bp
GenBank:DN834192 (1) 777 bp
CITATIONS (2)