ZFIN ID: ZDB-TSCRIPT-090929-18288
Transcript Name: gpc4-201
Previous Name: gpc4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037891 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037891|OTTDARG00000027978|ZDB-GENE-011119-1 gpc4|OTTDARP00000030364 gpc4-001 LG_none BX530080.5,BX537135.9 Danio rerio protein_coding KNOWN, 3998 bp
GCAACCAGAAGTGCCAATCGAAGAGATTTCGTGACTGAAC
CTTTTGTTTTGTATTCATTTTTGGTGCTTCATTACTTAAG
CAGTCAGCGATGAAGATGATCGTTGTGTTTACAGTATGTA
TGTCTGTGGTGGTTTTGGCGTCGGCTCAGGCTGATCAGAA
GTCAAAGAACTGCAATGAAGTCAGAACTGCCTACAGTTCC
AAAGGTTTCAACGTCAACGATGTTCCCAACAAAGGAGTGC
AGGGAGCCCATCTGAAGGTGTGTCCTCAAGGTTTCTCCTG
CTGTACTCTGGAGATGGAGGAGAAGTTGAGTCAGCTGAGC
CACGTAGACCTGAAAGTTCCCGTTCACCAGCTCAGCTCCA
ACCTGCAGAGCACCTTCACCCAGAGACACCGTCACTTTGA
CCAGTTCTTCAGAGAGCTGTTGGACAATGCAGAGAAGTCT
CTCAATCACATGTTTGTGCGGACGTATGGCTTGATGTACG
TCAAGAACAAAGAGCTCTTTGAGGGTTTCTTCAGTGATCT
GCGCCGCTACTACAGCCACGGCAGCAGTGAGGTCAATCTG
GACGACATGCTGGCCGAGTTCTGGTCTGAACTGCTGGAGC
GCATGTTTCGACTGGTCAACGTCCAGTACGAGTTCAGCGA
CTCCTACATGGAGTGTGTCAGCAGGCACACGGACCAGCTC
AAACCCTTCGGAGACGTTCCACGCAAGCTCCGTCTGCAGC
TGACCCGCTCCTTCATTGCTGTTCGCGCCTTCACTCGTGG
CCTCACACTCATGCCTGATGTGGTCCGCAAAGTCTCAACG
GTGAGCGCCTCACCGAGCTGTGTGCGCGCATCGATGAAGA
TGTTATACTGCCCGTACTGTAGCGGTCAGGTGGCGCTGAA
GCCCTGCAAGAACTACTGTCTGAATGTCATGAGGGGCTGT
CTGGCCAATCAGGCCGATCTGGACACAGAGTGGAATAACT
TCCTTGACTCCATGTTAGGTCTCGCTGAGAGGCTGGAGGG
ACCCTTTAACTTCGAGTCGGTCGTGGACCCCATTGATGTG
AAGATTTCAGATGCTATCATGAACATGCAGGAGAACAGCA
TGCAGGTCTCACAGAAGGTGTTTCAGGGTTGTGGGCAGCC
CAAACTCAGCATGGGCTTCCGCAGCCGGAGGTCTGCCAAA
GACTCGGGCTTCCCTGGCCGTTTTAGACCGTACAGCCCTG
AGGCCAGACCCACCACTGCTGCTGGCACCACCCTGGACCG
ACTGCTGACGGATGTCAAGAAGAAACTGAAGCATGCCAAG
AAGTTCTGGTCCACCCTGCCGGACACAGTGTGTGTTGGAG
AAAGGATCGCCCCCAGTGATGATTGCTGGAATGGTACAGC
TAAAAGCAGGTACGAATCTGTGGTTATGAGCAGCGGTTTA
GCCAATCAGGTGTCTAATCCAGACGTGGAGGTTGACATCA
CCAAACCAGACATGGTGATCCGGCGGCAGATCGCAGTCCT
GAAGGAAATGACCAGCTGGCTGAAAGCTGCTTACACCGGC
AACGACATCTCATTTACCTCCGATGATGCCGGCAGCGGAG
AGGAAAGCGGAAGCGGCTGCGACTCTCCCTCTTGCGAAGG
CGACGGAGATATTTACTTCTCCACCCCGGCACCTGGTAAA
CCTCGCATCCTCAAGACTCAGGAGGGCGAACAGGCCTCCA
GCGGCACACGGTTGGCACCCTGCAGCCTGGCACTGGCCCT
GGCCTCCCTTCTGCTCACCCTGCTCACTCTCCAAACAAGA
TAAAAGCAGAATCAGCCCAAGAAAGAGCAAGTGATTGGAC
AAATGTTTTTGACCGCGAGAGCAGAAAACTGCCACAGGAC
ATTAAAGACACTGCTTTCAGGATCTCCATCTGCCTTCCAT
CCGGGGAAGACACTCAAGTTATTAATATTCACACAACTTC
AGTGTATTTTTTTAATGTTTATAAGAGCGGACTCCATTTT
GTGTACAGCTATACGGCTCCATGCAGCATTGCGTCGTCTG
GGTCTTTACTTTTTTCTAGCATCAACAGTTTCTTTTATTT
CCCCACAGTGTTCGCAATTGAGAGAGTGTGTGTGTGTGTG
GATGGTGTGTTTGATTGGCTGTAAATATATATCATCCAAG
CGCTTTTTTTAAAAAGCTAAACAAATAATCAACCCATATA
ACACATGTATGATTTAAGCAAAGCTCTATTTTTATTCCAT
TATCAGTATGTGTGTTGGCGTGCGTGGAGGTTTCGGTTAG
CTATATGTGTTGCTGAAGTTCACGATGCCTTAAATGCTTC
ATGAAACGCCCTTTATCAGGTCTGCGATGGACAAAAGAAA
CACATTACGCTGCCTTATGAATGAATTGAGAACAGGATCC
CAGACATGCTGTTGGTTTTGTATTTTGTATTTGTTTCCAA
GCAAATTTCACAGCCCAAACGCTTTCAGCGATATAATATA
TAACTTGAGAATATAGTCTTCAGTAATAACTTAATAGTGC
GCGAAGAAGAGGAAGAAGAAGGAGCTTTGGATAAGTAAGG
TCTGTATGAAAGTCACTGATGAATAGGCCTTGATGGCTCA
AAGATGATCGTGCAGAGACATGACGTGGACTTCTGACTTA
ATGGACGATTAGTTATGAAGCAGCTGGAAAGGAGCTGAAT
TTTACACAGGGTTTTATATGGAGGTGTTTATTTTGCTAGA
AGTGTATTGTAAGGTTTAAAACTATATGATAGGTACTGCA
GCAGATTTCACAACGCAGCGACAGCCGGTGCTCGTTCCGA
GAGGTTGGGTGGCCTTGTTTAAAAACATCAAACGTCCATG
CTTTTCTAATTTCCATTGAAGGTGGTACACATTTTAAAAC
CATTCCTCACGTATAAATATAGCAATAGCCTTTGTGTGTG
GTACGAGCAGATTTTTTTCATTCGCACGTCTGACAAGAAA
AGCTCTCTTAATCTCAAGGACTTTCCACCCACCTCTCGGA
TATAAAAAAAAAAGACGGAAATCTTGCATCGCTTTTGTAC
AGTAAGTTATTTAACCACATCTCTTTGAAAGGCATTCGCA
AGCACCGCTTTCCTAGTATCTTCAATTCAGTATTGGAAAT
ATTTATGTCTCTAGATGATTTCACAGCTTCACTGATGGTT
TTATATCGGCTACAGATTTCATTTTATGTAACGTTTCCAT
TTTGTAAACCATTTTTATTGTTTTATATTAAGTGGGTGGT
GAAAATTGTACAAGCTGATGCAAGGACAGGGCTGGCCATC
GGTCCTTGATCGTTCCTAATGTCACATGCACTTTTTTAAA
AGATAAAAAAATTGGCATTCAGATACCTCACCGCAATTTT
AAATGTTGTTTTTAATCCTATCTGCGACGTGCACACGCTT
TTATTCATTCATTCAGTGTCTACGGATGAATGGCCAGTCC
TCAGACGTGAAAAGAAGTCTGAAATGAGTAAAGATCTGTG
CAGCAGTGATGCTCCGCACCTCAGATTGTTTGTTTGTTTG
TTTGTTTGTTTAAATTGAGGCATGAATAGGAAGCTGTACG
TGTTTTCTGTTCATCCCGATGACCCAAAGCTTCCCACAGT
CACATGTTTTATGATGGCTCTGATGTAAAGAAGACCAGGA
AAGGAGGAAGTGTCTTGTGCTTGTATGTGGAGCTGCTCTG
AGTCAGTGTGAAGATGACATGGACTTTACGGATCAGGAAA
GCGATCCTCTGCGGTGTCATCTTTAAGTTTGAGTGCTGAG
CTTCAGGCGGATGGATTGCAGAGCCTACAGCTCTGTACAT
CAGTGATGAGGAGGAGGAGGAGGAGGGAGAGAGACTAAAG
AAAGAAGAGGAGAAAAGAAAAACAATTGTAAATAATGAGC
AGTCGATTTAGTGGTCTCTGAGAGATGTTCATCAGATTTT
ACCCATTCAGAGTATGTGCTTAATATGGGCAAAACCAAGA
GAGATAGATGCTAAAAATGTAAGAGAAAAGTTATATTAAA
CATTTCTTAGTCTTGTTGAAATAAAGACTGCAGATATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpc4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037891 (1),  Ensembl_Trans:ENSDART00000026569 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC163403 (1) 1822 bp
GenBank:CO246705 (1) 930 bp
GenBank:CT699320 (1) 829 bp
GenBank:CT655696 (1) 805 bp
GenBank:CT601613 (1) 786 bp
GenBank:BI886906 (1) 630 bp
GenBank:CT601614 (1) 611 bp
GenBank:BI886035 (1) 604 bp
GenBank:AL924193 (1) 538 bp
GenBank:BI885693 (1) 530 bp
GenBank:AI964951 (1) 223 bp
CITATIONS (2)