Transcript

pdlim3b-202

ID
ZDB-TSCRIPT-090929-18283
Name
pdlim3b-202
Previous Names
  • pdlim3b-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037886 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037886|OTTDARG00000027973|ZDB-GENE-060130-104 pdlim3b|OTTDARP00000049205 pdlim3b-002 LG_none BX005225.22,BX001002.4 Danio rerio protein_coding KNOWN, 910 bp
AACGTGGTGCTGGATGGACCGGCCCCATGGGGATTTCGGC
TTTCAGGAGGCAAAGATTTCAACCAGCCACTGACCATAAC
TCGGGTGACTCCGGGCAGTAAAGCATCTCGGGTCAACCTG
TGTCCTGGAGACATCATTCTGTCCATCCAGGGAGTGTCTA
CAGACGGCATGACTCACGCTGAAGCCCAGAACAACATCAA
AGACTCAACCAATCAGCTTTTCCTCAAGATAGAGAGGCCT
GAAACAAAAATCTGGTCACCTCAGGTTATTGAAGAGGGGA
AGGTGAACCCATTCAAAATCAATTTGGAGGCAGAGAAGCA
AGACATTGATTACTTCGAACACAAGTTTAATGTCAGACCA
AAGCCCTTCACATCTGCAAGCCAAAGGAGTGACAGTACAT
CTCAGACGCTGATGGGAAATGTAGCTCAGATGGCTGGCAC
CCCATCGACAGCTCATTCTGTACAGTATAACTCCCCCGTT
GCATTATACTCGGCAGACAATGTATCAAATACATTGCAGC
AGGCTCAGATGTCCACTGTAGTCAGGCAGGCATCGCCCAG
CTCTAAACCGCTGACGTCTATTGAAGACTCCCATGTATAC
CGTATGCTCCAAGATGCCAACGAGCAGCCACATGAACCAC
GTCAGTCTGGATCATTTAAGGCCCTGCAAGACTATGTGGA
GAGTGATGGCACAAGGCCCATGGTGACTAGAAGTGTAAAA
GCTCCAGTGACAAAGCCCCAAGCCGCCACTTCTTCACTGC
AGAAGCTGCCTCTCTGTGATAAATGTGGCACAGGCATTGT
AGGAACGGTGGTGAAAGCTCGGGACAAGTACCGCCATCCA
GCCTGTTTTGTGTGCTCAGACTGCGGCATGAACTTGAAGC
AGAAGGGCTACTTCTTTGTGGATGGACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations