Transcript

pdlim3b-201

ID
ZDB-TSCRIPT-090929-18282
Name
pdlim3b-201
Previous Names
  • pdlim3b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037885 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037885|OTTDARG00000027973|ZDB-GENE-060130-104 pdlim3b|OTTDARP00000030359 pdlim3b-001 LG_none BX005225.22,BX001002.4 Danio rerio protein_coding KNOWN, 1353 bp
GAGCCTTTCGTCCAGAGCAGGAGCTGATTATTCTGTTCTC
TCTGGCCGACAAGAGGAAACTCCAAGCTCTTTTCAAAAAA
AGAAGATAAAAGAAACTAGACAGAAATGCCACAGAACGTG
GTGCTGGATGGACCGGCCCCATGGGGATTTCGGCTTTCAG
GAGGCAAAGATTTCAACCAGCCACTGACCATAACTCGGGT
GACTCCGGGCAGTAAAGCATCTCGGGTCAACCTGTGTCCT
GGAGACATCATTCTGTCCATCCAGGGAGTGTCTACAGACG
GCATGACTCACGCTGAAGCCCAGAACAACATCAAAGACTC
AACCAATCAGCTTTTCCTCAAGATAGAGAGGCCTGAAACA
AAAATCTGGTCACCTCAGGTTATTGAAGAGGGGAAGGTGA
ACCCATTCAAAATCAATTTGGAGGCAGAGAAGCAAGAGTA
TAAACCTATTGGCACAGGTCATAACAGAAGAGCACAGCCC
TTTGTGGCTGCCGCCAGTCTGGATGACAAAACACAGGTGG
TGAGCTCCACCTACAACACTCCCATAGGCCTCTACTCTCA
AGATAACATCCAGGACGCCCTGCAAGGACAGATCCGAGGT
CTGGTGCATGAAAAGCCTGAGGGCTCTAAACCGCTGACGT
CTATTGAAGACTCCCATGTATACCGTATGCTCCAAGATGC
CAACGAGCAGCCACATGAACCACGTCAGTCTGGATCATTT
AAGGCCCTGCAAGACTATGTGGAGAGTGATGGCACAAGGC
CCATGGTGACTAGAAGTGTAAAAGCTCCAGTGACAAAGCC
CCAAGCCGCCACTTCTTCACTGCAGAAGCTGCCTCTCTGT
GATAAATGTGGCACAGGCATTGTAGGAACGGTGGTGAAAG
CTCGGGACAAGTACCGCCATCCAGCCTGTTTTGTGTGCTC
AGACTGCGGCATGAACTTGAAGCAGAAGGGCTACTTCTTT
GTGGATGGACAGATGTACTGTGAAGCCCATGCTCGAATGA
GGATGACCCCACCAGAGGGACATGATCTAGTTACAGTGTA
TCCTACTGCTTAGACTGATGCCAAAACTCAGACCTCACGC
AAATGACAGCTGAAATCAGAGAGTTGGTAATTCATAGCTA
CTTCTTGAAGTTTTGTTAAAATCACAAATCTGGTTAGTAA
GTGGGCATTTGTACACAAGAACAATGCACTAAATGATGAA
TGGTTTTTCGTTTGTGTTTTTAAAAAGGTTGTATATACAA
ACCCAAATAAAATAAAGTTGGGACAGTATAGAAAACGTAA
AATAATAAAAGGAAAGTAGTAGGGATGTTCCAATCAGATT
TAACAATCAAGTAATAAATATCATAAATTCTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations