ZFIN ID: ZDB-TSCRIPT-090929-18261
Transcript Name: afp4-202
Previous Names: ottdart00000037864, zgc:161979-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037864 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037864|OTTDARG00000035766|ZDB-GENE-030131-5217 afp4|OTTDARP00000030345 DKEY-45N22.3-001 LG_ CR933818.11 Danio rerio protein_coding KNOWN, 603 bp
ACCCTTTGAACTTCTGCTGGGACTATAAAAACTCAGGACT
CTTTGGAAAAAGCACCATCAGGTCTAACAATCTCTGGACG
CAAGGCAACTCTTGCTCAACCCGCAATCATGAAATTCTCC
CTCATCGCCGTCATTGTTGTTGCTCTGGCCATCGGCTCTG
AGTCAGCATCTCTGGTCAAGAGAGACGCTCCTGCTGAGCT
GGACAAGATCGCCAAGTACTTCCAGGATTTAGTGGACAAT
CTGAAGAACGTTGAGGGTGCTGAGCTGGCCAACAAGGCCA
ATGCTTACCTGGAGCAGAGCAGAGCTCAGTTTCAGCCCAT
GGTTGAGAAGCTCCAGGAGCAGCTGAAGCCCTTCTCCGGC
AACATTGAAGAGCAGATCAAGCCTCTGGCTGCCTCCGTCC
AGTCTCAGGTTGCGCCGCTGGCCGGTATGGTCCAGACCCA
CGTTGAGGACATGATCAAATTTGTTGCTGACCAGGCCAAA
GCCATGCTGCCACCTCAGTAAACCCACAGGAATCTCCAAT
ACACAGTTCTCTTGCATTTTGTCACAGTATTTTTATTTGT
ATGCTGATGGTTTTGTTTAAATAAAAAAATGATTAAAAAG
TGA

afp4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA afp4-201 (1) 858
afp4-202 603
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
afp4-202 Contained in:
OTHER afp4-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037864 (1)
  • Ensembl_Trans:ENSDART00000060822 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH490672 (1) 634bp
    GenBank:AY345904 (1) 569bp
    GenBank:BC133822 (1) 542bp
    CITATIONS (2)