ZFIN ID: ZDB-TSCRIPT-090929-18261
Transcript Name: afp4-202
Previous Names: ottdart00000037864, zgc:161979-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037864 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037864|OTTDARG00000035766|ZDB-GENE-030131-5217 afp4|OTTDARP00000030345 DKEY-45N22.3-001 LG_ CR933818.11 Danio rerio protein_coding KNOWN, 603 bp
ACCCTTTGAACTTCTGCTGGGACTATAAAAACTCAGGACT
CTTTGGAAAAAGCACCATCAGGTCTAACAATCTCTGGACG
CAAGGCAACTCTTGCTCAACCCGCAATCATGAAATTCTCC
CTCATCGCCGTCATTGTTGTTGCTCTGGCCATCGGCTCTG
AGTCAGCATCTCTGGTCAAGAGAGACGCTCCTGCTGAGCT
GGACAAGATCGCCAAGTACTTCCAGGATTTAGTGGACAAT
CTGAAGAACGTTGAGGGTGCTGAGCTGGCCAACAAGGCCA
ATGCTTACCTGGAGCAGAGCAGAGCTCAGTTTCAGCCCAT
GGTTGAGAAGCTCCAGGAGCAGCTGAAGCCCTTCTCCGGC
AACATTGAAGAGCAGATCAAGCCTCTGGCTGCCTCCGTCC
AGTCTCAGGTTGCGCCGCTGGCCGGTATGGTCCAGACCCA
CGTTGAGGACATGATCAAATTTGTTGCTGACCAGGCCAAA
GCCATGCTGCCACCTCAGTAAACCCACAGGAATCTCCAAT
ACACAGTTCTCTTGCATTTTGTCACAGTATTTTTATTTGT
ATGCTGATGGTTTTGTTTAAATAAAAAAATGATTAAAAAG
TGA

afp4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA afp4-201 (1)    Ensembl 858
afp4-202 603
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
afp4-202 Contained in:
[BAC] DKEY-45N22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037864 (1),  Ensembl_Trans:ENSDART00000060822 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH490672 (1) 634 nt
GenBank:AY345904 (1) 569 nt
GenBank:BC133822 (1) 542 nt
CITATIONS (2)