ZFIN ID: ZDB-TSCRIPT-090929-18260
Transcript Name: rbm8a-201
Previous Names: rbm8a-001, zgc:110525-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037863 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037863|OTTDARG00000027963|ZDB-GENE-050306-51 rbm8a|OTTDARP00000030344 DKEY-45N22.4-001 LG_ CR933818.11 Danio rerio protein_coding KNOWN, 937 bp
GCAGTGTCGTATAGAGTGTTCTGCGCATGCTCACAGCCGC
TCACTCGCTTCTCACTCACAAGCAAGCATCATGGCGGACG
TACTGGATCTTCATGAAGCGGGAGGCGAAGACTTTCCTAT
GGACGAGGATGGCGATGAGAGCATTCATAAGTTAAAAGAG
AAAGCCAAGAAGAGGAAAGGTCGTGGATTTGGATCTGAGG
AAGGAGCCAGATCTAGAGTCAGAGAGGACTATGACACAGT
AGAACAGGATGGAGATGAGCCTGGACCACAGAGATCTGTT
GAAGGATGGATTCTGTTTGTGACCGGTGTTCACGAGGAGG
CAACAGAGGAGGATGTCCACGACAAGTTTGCAGAGTTTGG
AGAAATCAAGAACTTGCATTTAAATTTGGACAGGAGAACC
GGTTACCTTAAGGGCTATGCATTGGTGGAGTACGAGACCT
ACAAAGAAGCACAGGCTGCAATGGAGGGTCTGAATGGTCA
AGAACTTATGGGACAACCAATCAGTGTTGACTGGTGCTTT
GTAAGGGGACCCCCGAAGAGCAAGAGGAGGGGTGGAAGGA
GGCGCAGCAGGAGTCCTGACAGACGGCGACGCTGATTTTA
CCCCTGTTTGCCTCCGGTGTCTGTTTCCCAGCCGCTGTGG
GATCATTTTTCAACACAGTTTGGAGTCAGATTGAAGTGTA
TCTCTTTAAATAAAGGTTTTAGTGGGTTTTTTCCTCGTAA
TTGTTAGTTTTTCAGCATCTGCCTGGTGGCATTTTGTTAA
TGAAGTTGCTGACACGTACATGTTAAACCTGTTGGTATTT
TCAACACCATTTTATTTACTTTTTTTTTGTACAAAGTGGA
AGTTCACTTTAAAATGTATGTGGATTGACATGTATTCACT
CATTGAAACTCGTTGTTGTGAGTAGTGATCTGTATATTTC
CAATAAATTAATTTGGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rbm8a-201 Contained in:
OTHER rbm8a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037863 (1)
  • Ensembl_Trans:ENSDART00000018253 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC090261 (1) 910bp
    GenBank:AW305654 (1) 562bp
    CITATIONS (2)