ZFIN ID: ZDB-TSCRIPT-090929-18232
Transcript Name: ran-201
Previous Name: ran-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037835 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037835|OTTDARG00000027948|ZDB-GENE-990415-88 ran|OTTDARP00000030326 ran-003 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 1247 bp
TGATGTGACTAACCGTCCCGCCATCTCTCCCGCAGAGTGA
CTGCAGCACAAAGACCAACACACACTCACAGTACAGCGAT
GGCGGAGAACGAGCCACAAGTTCAGTTTAAGCTGGTTCTG
GTAGGTGATGGAGGTACGGGGAAAACCACCTTCGTGAAGA
GACACTTGACTGGGGAGTTTGAAAAGAAATATGTTGCTAC
ACTTGGAGTTGAGGTACATCCCCTGGTCTTCCACACTAAC
AGAGGAGCCATCAAATATAATGTATGGGACACAGCCGGAC
AGGAGAAGTTCGGTGGCCTGAGAGATGGCTATTACATCCA
GGCTCAATGTGCAATCATCATGTTTGATGTAACTTCTCGA
GTGACCTACAAAAATGTGCCCAACTGGCATCGTGACTTGG
TGCGCGTGTGCGAGAACATTCCCATAGTGCTTTGTGGTAA
CAAAGTGGACATCAAGGACAGGAAGGTCAAAGCAAAGAGC
ATCGTGTTTCACCGTAAGAAGAATCTACAGTACTATGACA
TCTCTGCCAAGAGTAATTATAACTTTGAGAAGCCCTTCCT
GTGGCTCGCACGGAAGCTGATTGGAGATCCCAATCTGGAG
TTTGTGGAAATGCCTGCTCTTGCACCACCTGAAATTGCTA
TGGACCCAACACTTGCTGCACAGTATGAGCACGACTTGAA
AGTGGCATCAGAAACAGCTCTCCCAGATGAAGATGACGAT
CTTTAACCTGTTAGCCTCTGACCTCATGGCGATGTCACTG
TTTCCTGGTGACGGGTCCTTCCCCTGCCCCTTTTACTGTA
CAACCTTCCCTCCCCCAGCGCAGAATATTTTTATTTTTCA
ATTTTCGGTTTTTTGTTTTGTGTTTTGAATTTGAGTAAAT
TGTGTGGTTGATTTCATTGTAGACATGCTAACTGTTTCCA
CCAGATACACACATGCAGACATGCCTACACATTGACACAT
TCGCTCACTCAAAGGTGTGAGAGCAGGCTAAGTGTCCCAG
TGCTTACTTCGATATGTAAGGCTCTAAGCACTTAGAGGAA
TTCTTGGAATAAAAACATTCTCAATATAACCTTGCCTGGT
TTCTCCTCAATTTATTTGACCTGAATTTGATAATGTCTCT
GAAAATAAAACTATTGGTTGAGTATCTTGTGTAATCGTTG
TATTCATCAGCTACTCTGTGTTTTTAATCTGTGCTGTTGT
TTCAACCGTATTTAGTGCTGGATAAAGATTAATCGCATCC
AAAATAA

ran TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ran-201 1247
ran-202 (1)    Ensembl 1319
ran-204 (1)    Ensembl 929
ncRNA ran-004 (1)    Ensembl 780
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ran-201 Contained in:
[BAC] DKEY-83D4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037835 (1),  Ensembl_Trans:ENSDART00000034438 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC058047 (1) 1222 nt
GenBank:CN502082 (1) 871 nt
GenBank:CK354299 (1) 862 nt
CITATIONS (2)