ZFIN ID: ZDB-TSCRIPT-090929-18231
Transcript Name: ran-204
Previous Name: ran-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037834 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037834|OTTDARG00000027948|ZDB-GENE-990415-88 ran|OTTDARP00000030325 ran-002 LG_ CT955967.12 Danio rerio protein_coding KNOWN, 929 bp
ACTTCAACACCGGTGAGTGCGGAACGACTGCGTTCATCTC
ATCACACACTCTTTTCACTAACACGTTTTATTTTCAGCGC
CGACTAAACACACCTGAAAGCTTTTCTGCAGTTCCCAGGC
GCTAAGTGACTGCAGCACAAAGACCAACACACACTCACAG
TACAGCGATGGCGGAGAACGAGCCACAAGTTCAGTTTAAG
CTGGTTCTGGTAGGTGATGGAGGTACGGGGAAAACCACCT
TCGTGAAGAGACACTTGACTGGGGAGTTTGAAAAGAAATA
TGTTGCTACACTTGGAGTTGAGGTACATCCCCTGGTCTTC
CACACTAACAGAGGAGCCATCAAATATAATGTATGGGACA
CAGCCGGACAGGAGAAGTTCGGTGGCCTGAGAGATGGCTA
TTACATCCAGGCTCAATGTGCAATCATCATGTTTGATGTA
ACTTCTCGAGTGACCTACAAAAATGTGCCCAACTGGCATC
GTGACTTGGTGCGCGTGTGCGAGAACATTCCCATAGTGCT
TTGTGGTAACAAAGTGGACATCAAGGACAGGAAGGTCAAA
GCAAAGAGCATCGTGTTTCACCGTAAGAAGAATCTACAGT
ACTATGACATCTCTGCCAAGAGTAATTATAACTTTGAGAA
GCCCTTCCTGTGGCTCGCACGGAAGCTGATTGGAGATCCC
AATCTGGAGTTTGTGGAAATGCCTGCTCTTGCACCACCTG
AAATTGCTATGGACCCAACACTTGCTGCACAGTATGAGCA
CGACTTGAAAGTGGCATCAGAAACAGCTCTCCCAGATGAA
GATGACGATCTTTAACCTGTTAGCCTCTGACCTCATGGCG
ATGTCACTGTTTCCTGGTGACGGGTCCTTCCCCTGCCCCT
TTTACTGTACAACCTTCCCTCCCCCAGCGCAGAATATTTT
TATTTTTCA

ran TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ran-201 (1)    Ensembl 1247
ran-202 (1)    Ensembl 1319
ran-204 929
ncRNA ran-004 (1)    Ensembl 780
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ran-204 Contained in:
[BAC] DKEY-83D4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037834 (1),  Ensembl_Trans:ENSDART00000144503 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN019564 (1) 934 nt
GenBank:DV590644 (1) 756 nt
GenBank:EB789328 (1) 439 nt
GenBank:EB868761 (1) 232 nt
CITATIONS (2)