Transcript

pcnxl4-002

ID
ZDB-TSCRIPT-090929-18069
Name
pcnxl4-002
Previous Names
  • zgc:158219-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037668 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037668|OTTDARG00000027843|ZDB-GENE-070209-185 pcnxl4|no_translation DKEY-15F17.7-002 LG_ BX072537.8 Danio rerio protein_coding KNOWN, 927 bp
TCCGAAGTATCGTCAATCTATAGCAATCGATTATTGATTG
GCTTCAGTACTAGAAGGCAGGATTTTTTTACCAAATGGCG
ATCGATGATTGGCTCCTGTACTAGTAGACGGGGCTTTATT
CACCATGTTGACCGTTACACTTATCCACATTCAAAAATAA
ACGAGTAACATGTCTTGTGTATTCTGTAATCTTCGGTAAT
ATTCATACAACACTTTTATGCTTTATTATTAACTGATTAA
AGTTTTTGTAACTGGTTGCAGGATCCTGCACTCCAGGGTC
TCATTACCTAGGCCGCTTTCAGGGTCGTCTTCTGTGGATC
TCGATTCTAGAAAAGGGCTATGGCTATTGCACAGTCAACA
TTAAGGGTCTGGAACTACAGGAGACATCATGCCACACAGT
GGAAGCTCGGCGTGTGGACGAGGTTTTCGAAGGAGCGTTT
GATCACGTGGAGCGGCCAGGCCAGTGTTTCAGACTATTGA
ACCCTAACTGGGGTAACGCTCTTATCCCCTGCTCTCTGTT
GCCCGTCAGGGTTTACTCTGATGCCCAGAGCGTTCTAACG
GGAATTATTGACTCACCCGATCACCTGCGTCAGCTAAACT
CTGACTTCCTCAAAACACTTGTCTGGATTCTATTGCGTTA
CTGTGTACAGGAATTCACATGCGGTGCTCAGCGAACTAAA
GGTCAGACTTTACAGACCTCTGGACGTAAGTCACAAAGCT
CCCAGCATCCTGTGCCCTCAGAGGCAGGTCCAGCTGTGAT
CAAAGTGGAGACTCAAGTACGCCCTGAATCCTCCTCGTCC
TCTCACTTGAGGGGTCTGGACAGCTCCAGCCTGTCGTCCT
TTGCTGATTGGTCAGACGAGGATGATCTGTTTGGTCCAGT
CCCTGTGCGACGACCGATGAGAATGATGGTGCGGACAGAT
GAAGCGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations